SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06013
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.009
 

Sequence

CDS
ATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCAAGGGAACCCGCTCCTCCCCACGACCTCTCGCGGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACATATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTAGACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGAGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGTAACCTAA
Protein
MEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVKGTRSSPRPLAAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLDDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDPGNRTRRTRQRGRRVT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081103    AAC72921.1    AF081101    AAC72919.1    KQ459580    KPI99178.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    ABLF02014862    ABLF02014866    ABLF02061908    KQ973342    KXZ75569.1    ABLF02042518    ABLF02057746    ABLF02008933    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    GEZM01038405    JAV81653.1    GGMR01016114    MBY28733.1    KK117880    KFM71667.1    GALX01005300    JAB63166.1    GGMS01004685    MBY73888.1    GGMS01000737    MBY69940.1    GGMS01012005    MBY81208.1    GGMR01018716    MBY31335.1    ABLF02033757    GGMS01002955    MBY72158.1    GGMS01008766    MBY77969.1    GBBI01004395    JAC14317.1    GGMR01000676    MBY13295.1    GBBI01004571    JAC14141.1    AF012049    AAC24972.1    GFTR01008038    JAW08388.1    NEVH01002704    PNF41489.1    NEVH01006736    PNF36716.1    NEVH01000269    PNF43694.1    GGMS01006359    MBY75562.1    GEZM01053022    JAV74219.1    KK113014    KFM59099.1    GFXV01006424    MBW18229.1    NEVH01020940    PNF20481.1    GFXV01007093    MBW18898.1    NEVH01017542    PNF24034.1    GGMS01017914    MBY87117.1    KL813758    KFM83187.1    GGMR01004661    MBY17280.1    NWSH01000032    PCG80497.1    GBGD01000880    JAC88009.1    NEVH01006721    PNF37225.1    LBMM01014395    KMQ85192.1    ABLF02008463    GBGD01000799    JAC88090.1    ABLF02020655    ABLF02039168    ABLF02061060    GGMR01003407    MBY16026.1    RPOV01000134    RPJ78669.1    GFXV01000774    MBW12579.1    PYGN01000192    PSN51582.1    ABLF02034467    NEVH01012089    PNF30491.1    NEVH01026386    PNF14434.1    GEZM01097906    JAV54051.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01007393    PNF35987.1    NEVH01007578    PNF35646.1    NEVH01022639    PNF18527.1    ABLF02024246    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    AY060438    AAL25477.1    ABLF02037660    LBMM01010106    KMQ87671.1    GGFJ01001857    MBW50998.1    GGMR01014053    MBY26672.1    GDHC01014349    JAQ04280.1    NEVH01016302    PNF25823.1    NEVH01011193    PNF32021.1    GGFJ01001858    MBW50999.1    PCG80496.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01026106    PNF14658.1    S59870    AAB26437.2    KK115908    KFM66338.1    JXUM01241784    KQ635293    KXJ62492.1    GBBI01001646    JAC17066.1    NEVH01003017    PNF40781.1    GFDF01007661    JAV06423.1    NEVH01023962    PNF17612.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01020071    PNF21969.1    NEVH01007443    PNF35684.1    NEVH01010546    PNF32261.1    NEVH01018383    PNF23463.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBYB01008290    JAG78057.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMS01002992    MBY72195.1    NEVH01005938    PNF38077.1    AF237761    AAF81411.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
512
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
16.26398
Exp number, first 60 AAs:
13.00592
Total prob of N-in:
0.43718
POSSIBLE N-term signal
sequence
outside
1  -  512
 
 

Population Genetic Test Statistics

Pi
0.68024
Theta
1.728674
Tajima's D
-1.896439
CLR
22.596715
CSRT
0.0119494025298735
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号