SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05983
Pre Gene Modal
BGIBMGA002890
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 1.12 PlasmaMembrane   Reliability : 1.106
 

Sequence

CDS
ATGTTTACGTCAGAAAATAATGACGACTATGACTGCTCTTTACTAACATACAAAGAAGCTGTGACTGGCACCGACAGACGAAATTGGGAGAAGGCGATACAATCTGAAATGGAATCATTACAGAAAAATAATACCTGGGTATTAGTAGACAAGTCAGAAGCCAAAGGACACAAAATACTGTCGAACAAATGGGTATTTCGGATTAAAGATGACGGTACGTACAAGGCTAGATTAGTCGTACGTGGATGCGAGCAGAAAGGAAACCTGGATTTCGAAGACATTTATAGCCCAGTAGTAAGTCAATCTGCATTAAAAACTTTATTAGCAATTGCCGCATCTAAATCTTACTACTTCATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGACTAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAATCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCATAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATAGTTCTTACTCAGAGATCCTACATAATTGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTCGAAAACCCTACTAGAGAAGACGTTACCAAAGTCAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTGTTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGCGACTCGGATTATGCTGGAGACCCATTGACGCGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACTGAAGCCGAGTACATAGCCGCAGCAGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTACAGGAAACAACCGGTTTGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGCCGCACAGTCTGCGAGTATCGTTGCCGTGAGATGAGTGGTCGCGAGCTGATCGCAGCGTATAAGATATGGCTCTTATTTGGAGCCCTAGCGGAAGTCGTGACGGGCACGGGTTTTGGGAGATGCCCGGCCTACCCGTCTCTACCGAATTTTGACGCACAGAGGATGACCGGCATTTGGTACGAAGTGGAGCGTTCGTTCTACTTGGTGGAGATAGCCGCGAGTTGCACCCGACTTAATGTCACCCTTAACGACAGGGGTTACTTCCAGATCACCGTCGATTCTGTCAACAGATGGACAGGAAGCCAGTCAACTTCATACGGCATCGGCATTCCGTCGTACAATGGGTCGTCAGTGTTTCGATATAAACTAAACAACCGCATGCCTTATTTGATTGGGAGGCTGCTCCCGGGCGCGGGGCAGTACAACATACTCTTCACGGATTACGATCAGTTCGCGCTCGTCTGGTCCTGTAGTAGCGTCAGTCTTGCGCATTCAGATCGAATTTGGGTGTTAGGCCGAAAACAAGAGATCGAAGCGGACGTCCGAGTTCAGATCTACGCCATCATGCAAGAACTGAGACTGGACCCAGACAGGCTGTTCATATCCAAAAACACTAACTGCACCGACTCATTGGAGGCTGAATAA
Protein
MFTSENNDDYDCSLLTYKEAVTGTDRRNWEKAIQSEMESLQKNNTWVLVDKSEAKGHKILSNKWVFRIKDDGTYKARLVVRGCEQKGNLDFEDIYSPVVSQSALKTLLAIAASKSYYFMTFDIKTAFLYGELSDEVYMKLPVGYETNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVIGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIVLTQRSYIIDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNLVSRKVENPTREDVTKVKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQETTGLDIKINLHVDNQSSIQLVKSGSFNKSRTVCEYRCREMSGRELIAAYKIWLLFGALAEVVTGTGFGRCPAYPSLPNFDAQRMTGIWYEVERSFYLVEIAASCTRLNVTLNDRGYFQITVDSVNRWTGSQSTSYGIGIPSYNGSSVFRYKLNNRMPYLIGRLLPGAGQYNILFTDYDQFALVWSCSSVSLAHSDRIWVLGRKQEIEADVRVQIYAIMQELRLDPDRLFISKNTNCTDSLEAE

Summary

Similarity
Belongs to the terpene synthase family.
Pfam
PF07727   RVT_2        + More
PF00098   zf-CCHC
PF00665   rve
PF13976   gag_pre-integrs
PF01397   Terpene_synth
PF03936   Terpene_synth_C
Interpro
IPR013103   RVT_2        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR025724   GAG-pre-integrase_dom       
IPR008949   Isoprenoid_synthase_dom_sf       
IPR005630   Terpene_synthase_metal-bd       
IPR008930   Terpenoid_cyclase/PrenylTrfase       
IPR034741   Terpene_cyclase-like_1_C       
IPR036965   Terpene_synth_N_sf       
IPR001906   Terpene_synth_N       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
SSF48576   SSF48576       
SSF48239   SSF48239       
Gene 3D
PDB
2HZR     E-value=3.05069e-11,     Score=167

Ontologies

Topology

Length:
676
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.50238
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01399
outside
1  -  676
 
 

Population Genetic Test Statistics

Pi
22.272452
Theta
24.41466
Tajima's D
-0.857142
CLR
1.619475
CSRT
0.165291735413229
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号