SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05966  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002901
Annotation
PREDICTED:_esterase_FE4-like_[Bombyx_mori]
Full name
Carboxylic ester hydrolase      
Location in the cell
Cytoplasmic   Reliability : 1.034
 

Sequence

CDS
ATGCTGCGATTGGTTGCTCTGTTAGGCTTGTTGTCGGCGGTGGCTGCCCGGTTGAGGGTAGACCCCCTTGTTGATACTCAGCGGGGACTCATCAGGGGACTGAGGTCCGAAAATGGAAAGTTCGCGAAGTTTTTGGGCATACCGTACGCACTAGTTGATGAGAACAATCCTTTCGGGCCATCAGTACCACACCCTGGTTTCGAAGAGACATTCGAAGCATACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTTCAGTGTTTGAACCTGAACGTTTATGTCCCAAACACAGCTACATCGCGCAACAAGCGCCCCGTGATGATTTGGATCCACGGAGGAGGCTTCGCCACCGGCAGTGGGACAGGCAGGGACTTCTCCTACGACGACCTGGTCCGACATGACGTCATCGTCGTATCGGTCAACTACCGACTCGGACCCTACGGGTTCTTATGCTTGGACAGTCCTGATATTCCCGGGAACCAGGGTTTGAAGGATCAAGCTCTTGCTCTCAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGTCTCTAAAATAACCTTGTTCGGAGAGAGTGCTGGTGGCATCGCTGTCGAGCTACACCTACTGACCGACCAGGATAAACTGTTCAATCAGGTGATCATCCAGAGTGGATCTGTTTTCTTTGCTGGGGGTATTAGGAAACCTAGCAACCGTGTTCCAATAGAAATAGCAAGCCAGCTGGGATTCGAAACTGACAACTTCGTAGAGGCGGTAAAGTTTCTGGCCGGTCAAGACCCCCACCTGGTGGTCGCAGCGAGCACTTCTCAAAGCTCTGCCATAAGAGGCGGTACTCTTAGACCTTGCCGAGAGAACAAATACGACGGAGTTGGCAATTTTCTTTCGGATTTTCCTGAAAATTTAAGGGCTAGAAACATTCCTGCTATTTATGGAGTAACCAATAAAGAATTTCTAACATTACATGCTTATGTGACCCCAGAAGATTACGAGGTGACAGGAATTCGAACTTTTCTGGAACGGGCTTTCAACTTGACCGATAGCGAGATGGAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGCAGTTCGATGAGTTTATAGATTTTGCATCGGACTATTACTTTAACTACGGCGTCCAGCGGTCTATTAAGAAGTCATTGGCAGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGCAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATTTGGTCCCGGGACAACACATCGCCGAGGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCAAATTTTGCTAAATACAGCAACCCCACCCCTGAGCCGACGGACCTGCTGCCGGTCGTGTGGACGACAGTAGAAGGTAACAAGCGGCCGTATCTGGACATCGACACCGACCTGCAGCTCAGAAGCAGGCCCTTCCACCACCGGATGGCCTTCTGGGATCTCTTCTATAAGCTCTATGGAGAATTGGAACGCAGGAACTAG
Protein
MLRLVALLGLLSAVAARLRVDPLVDTQRGLIRGLRSENGKFAKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMIWIHGGGFATGSGTGRDFSYDDLVRHDVIVVSVNYRLGPYGFLCLDSPDIPGNQGLKDQALALRWIKENIEAFGGDVSKITLFGESAGGIAVELHLLTDQDKLFNQVIIQSGSVFFAGGIRKPSNRVPIEIASQLGFETDNFVEAVKFLAGQDPHLVVAASTSQSSAIRGGTLRPCRENKYDGVGNFLSDFPENLRARNIPAIYGVTNKEFLTLHAYVTPEDYEVTGIRTFLERAFNLTDSEMEDHVRHFYIGDETLTEKQFDEFIDFASDYYFNYGVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKQYLGITAEGAAHADELGYLLAVDLVPGQHIAEEDQLIIDRITTLWANFAKYSNPTPEPTDLLPVVWTTVEGNKRPYLDIDTDLQLRSRPFHHRMAFWDLFYKLYGELERRN

Summary

Similarity
Belongs to the type-B carboxylesterase/lipase family.
Feature
chain  Carboxylic ester hydrolase
EC Number
3.1.1.-
EMBL
BABH01018991    BABH01018992    BABH01018995    BABH01019018    BABH01018984    BABH01018985    + More
KQ459564    KPI99621.1    ODYU01001845    SOQ38611.1    SOQ38612.1    KZ150007    PZC75160.1    NWSH01000660    PCG74962.1    FJ997304    ADF43469.1    KQ460400    KPJ14974.1    KQ459606    KPI91074.1    NWSH01000356    PCG77070.1    KY021858    AQY62747.1    KZ149903    PZC78410.1    BABH01007753    PCG77069.1    SOQ38609.1    SOQ38610.1    BABH01021273    SOQ38607.1    SOQ38608.1    ODYU01001525    SOQ37859.1    KY304479    AUN86410.1    KC200270    AGG20205.1    EU523536    ACB12415.1    BABH01001500    KQ459837    KPJ19757.1    KY021842    AQY62731.1    NWSH01000067    PCG79999.1    KPI91073.1    SOQ38604.1    FJ997307    ADF43472.1    EU523532    ACB12411.1    KPI99620.1    AGBW02008309    OWR53771.1    PZC78409.1    JTDY01001549    KOB73566.1    FJ997305    ADF43470.1    FJ997306    ADF43471.1    OWR53772.1    SOQ38605.1    KPI99618.1    JTDY01003780    KOB69017.1    ODYU01010533    SOQ55708.1    KPI91075.1    KPJ19760.1    KPI99616.1    PCG74961.1    MG846884    AXY94736.1    KQ460205    KPJ17125.1    KY021841    AQY62730.1    PZC78414.1    NWSH01000834    PCG73942.1    PZC78412.1    PZC78411.1    ODYU01008680    SOQ52463.1    KY021848    AQY62737.1    KZ150132    PZC73036.1    EU688968    ACD80422.1    SOQ38606.1    PCG74959.1    PCG74960.1    NWSH01001418    PCG71299.1    KY021850    AQY62739.1    SOQ37858.1    KJ023212    AIY69040.1    JTDY01003106    KOB70142.1    RSAL01000258    RVE43396.1    SOQ38613.1    KQ460947    KPJ10567.1    RVE43394.1    BABH01001182    KC200271    AGG20206.1    KY021887    AQY62776.1    ODYU01006598    SOQ48575.1    KPI91162.1    BABH01003066    EU523534    ACB12413.2    FJ556877    ACL83460.1    JTDY01003509    KOB69443.1    OWR53773.1    DQ680829    ABH01082.1    KZ150117    PZC73246.1    JTDY01004572    KOB67996.1    KP001149    AJN91194.1    KY021884    AQY62773.1    FJ652455    ACV60239.1    MF687628    ATJ44554.1    PZC73247.1    KU375432    APD13874.1    JX306730    AFO65061.1    MF687561    ATJ44487.1    FJ997308    ADF43473.1    KZ149946    PZC76749.1    KP001158    AJN91203.2    NWSH01000400    PCG76673.1    JTDY01000777    KOB75922.1    NWSH01002285    PCG68674.1    KY021873    AQY62762.1   
Pfam
PF00135   COesterase
Interpro
IPR002018   CarbesteraseB        + More
IPR019826   Carboxylesterase_B_AS       
IPR002168   Lipase_GDXG_HIS_AS       
IPR029058   AB_hydrolase       
IPR000997   Cholinesterase       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
6EMI     E-value=4.74645e-42,     Score=432

Ontologies

Topology

SignalP
Position:   1 - 16,         Likelihood:  0.970867
 
 
Length:
533
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0248999999999999
Exp number, first 60 AAs:
0.02182
Total prob of N-in:
0.00141
outside
1  -  533
 
 

Population Genetic Test Statistics

Pi
126.779913
Theta
87.079697
Tajima's D
0.934624
CLR
0.003012
CSRT
0.63916804159792
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 HFYIGDETLTEK 100.00 9e-05
28556443 AYVTPEDYEVTGIR 100.00 0.005
28556443 ENIEAFGGDVSK 100.00 0.005
28556443 LNVYVSNTATSR 100.00 0.005
28556443 YAPSIPK 100.00 0.005
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号