SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05965  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002901
Annotation
Liver_carboxylesterase_[Papilio_machaon]
Location in the cell
PlasmaMembrane   Reliability : 1.117
 

Sequence

CDS
ATGCCTCATACTCTTCGTCTTCTGATGAGAGGTTCTTCAGCACCGCATCCATCAACAACGGGAGTCTCGTCACTCGCTGCATCGGTAGCACCAGGAACGAGTGGAGGGATAGACTCTGGCAAGCCGGGTGACTCTCTAGCCTGTGACCGAGTGATAAATATAGCTTTCTCTCGATCTGCGCACATTGCAAGTATGCTGCGATTGGTTGCTCTGTTAGGCTTGTTGTCGGCGGTGGCTGCCCGGTTGAAGTTAGACCCCCTTGTTGATACTCAGCGGGGACTCATCAGGGGACTGAGGTCCGAAAATGGAAAGTTCGCGAAGTTTTTGGGCATACCGTACGCACTAGTTGATGAGAACAATCCTTTCGGGCCATCAGTACCACACCCTGGTTTCGAAGAGACATTCGAAGCATACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTTCAGTGTTTGAACCTGAACGTTTATGTCCCAAACACGGCTACATCGCGCAACAAGCGCCCCGTGATGATTTGGATCCACGGAGGAGGCTTCGCCACCGGCAGTGGGACAGGCAGGGACTTCTCCTACGACGACCTGGTCCGACATGACGTCATCGTCGTATCGGTCAACTACCGACTCGGACCCTACGGGTTCTTATGCTTGGACAGTCCTGATATTCCCGGGAACCAGGGTTTGAAGGATCAAGCTCTTGCTCTCAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGTCTCTAAAATAACCTTGTTCGGAGAGAGTGCTGGTGGCGTCGCTGTCGAGCTACACCTACTGACCGACCAGGATAAACTGTTCAATCAGGTGATCATCCAGAGTGCATCTGCTTTCTTTGCTGGGGGTATTAGGAAACCTAGCAACCGTGTTCCAATAGAAATAGCAAACCAGCTGGGATTCGAAACTGACAACTTCGTAGAGGCGGTAAAGTTTCTGGCCGGTCAAGACCCCCACCTGGTGGTCGCAGCCAGCACTTCTCAAAGCTCTGCCATAAGAGGCGGTACTCTTAGACCTTGCCGAGAGAACAAATATGACGGAGTTGGCAATTTTCTTTCGGATTTTCCTGAAAATTTAAGGGCTAGAAACATTCCTGCTATTTATGGAGTAACCAATAAAGAATTTCTAACATTACATGCTTATGTGACCCCAGAAGATTACGAGGTGACAGGAATTCGAACTTTTCTGGAACGGGCTTTCAACTTGACCGATAGCGAGATGGAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGCAGTTCGATGAGTTTATAGATTTTGCATCGGACTATTACTTCAACTACGCCGTCCAGCGGTCTATAAAGAAGTCATTGGCTGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGCAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATGCGGTCCCGGGACAACACATCGCCGATGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCTAATTTTGCTAAATACGGAGTAGCCAGTGCATCCATGCATGCCTCATACTCTTCGTCTTCTGATGAGAGGTTCTTCAGCACCGCATCCATCAACAACGGGAGTCTCGTCACTCGCTGCATCGGTAGCATCAGGAACGAGTGGAGGGATAGACTCTGGCAAGCCGGTGCAAGTATGCTGCGATTGGTTGCTCTGTTAGGCTTGTTGTCGGCGGTGGCTGCCCGATTGAGGATAGACCCGCTGGTTGATACTCAGCGGGGACTCATCAGGGGACTGAGGTCTGAAAATGGAAAGTTCGCGAAGTTTTTGGGCATACCGTACGCACTAGTTGATGAGAACAATCCTTTCGGGCCATCAGTACCACACCCTGGATTCGAAGAGACATTCGAAGCGTACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTCCAGTGTTTAAACCTGAACGTTTATGTCCCAAACACGGCTACATCGCGCAACAAGCGCCCCGTGATGATTTGGATTCACGGAGGAAGCTTCGCCACCGGCAGTGGGACAGGCAGGGACTTCTCCTACGACGACCTGGTCCGACATGACGTCATCGTTGTATCGGTCAACTACCGACTCGGACCCTACGGGTTCTTATGCTTGGACAGTCCTGATATTCCCGGCAACCAGGGTTTGAAGGATCAAGCTCTTGCTCTCAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGTTTCTAAAATAACCTTATTCGGAGAGAGTGCTGGCGGCGTCGCTGTCGATCTACACTTACTGACCGACAAAGATGAACTGTTCAATCAGGTGATCATTCAGAGTGGATCTGCTTTCTTTGCTGGGGGTATTAGAAAACCTAACAACCGTGTTCCAATAGAAATAGCGAGCCAACTGGGATTCGAAACTGATAACTTCGCAGAGGCGATAAAGTTTCTGGTCGATCAAGACCCCCACCTGGTGGTCGCAGCTAGCACTTCTCAAAGATCTACCTTAGGAGGCAACACCCTCAGACCTTGCCTAGAGAACAAATACGACGGAGTTGACAGTTTTCTTTCCGACTTTCCTGAAAATTTAAGGGCTAGAAACATTCCTGCTATTTATGGAGTAAACAATAAAGAATTTCTTACATTACATGCTTTTGTGACCCCAGAAGATTACGAGGTGACAGGAATTCGAGCTTTTCTGGAACGGGCTTTCAACTTGACCGATAGCGAGATGGAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGTTTTTCGATGAGTTTATAGATTTTGCATCGGACTATTACTACAACTACGGCGTCCAGCGGTCTATTAAGAAGTCATTGGCTGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGCAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATGCGGTCCCGGGACAACACATCGCCGAGGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCTAATTTTGCTAAATACGGCAACCCCACCCCTGAGCCGACGGACCTGCTGCCGGTCGTGTGGACGACAGTAGAAGGTAACAAGCGGCCGTATCTGGACATCGACACCGACCTGCAGCTCAGAAGCAGGCCCTTCCACCACCGGATGGCCTTCTGGGATCTCTTCTATAAGCTCTATGGAGAATTGGAGCGCAGGAACTAG
Protein
MPHTLRLLMRGSSAPHPSTTGVSSLAASVAPGTSGGIDSGKPGDSLACDRVINIAFSRSAHIASMLRLVALLGLLSAVAARLKLDPLVDTQRGLIRGLRSENGKFAKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMIWIHGGGFATGSGTGRDFSYDDLVRHDVIVVSVNYRLGPYGFLCLDSPDIPGNQGLKDQALALRWIKENIEAFGGDVSKITLFGESAGGVAVELHLLTDQDKLFNQVIIQSASAFFAGGIRKPSNRVPIEIANQLGFETDNFVEAVKFLAGQDPHLVVAASTSQSSAIRGGTLRPCRENKYDGVGNFLSDFPENLRARNIPAIYGVTNKEFLTLHAYVTPEDYEVTGIRTFLERAFNLTDSEMEDHVRHFYIGDETLTEKQFDEFIDFASDYYFNYAVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKQYLGITAEGAAHADELGYLLAVDAVPGQHIADEDQLIIDRITTLWANFAKYGVASASMHASYSSSSDERFFSTASINNGSLVTRCIGSIRNEWRDRLWQAGASMLRLVALLGLLSAVAARLRIDPLVDTQRGLIRGLRSENGKFAKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMIWIHGGSFATGSGTGRDFSYDDLVRHDVIVVSVNYRLGPYGFLCLDSPDIPGNQGLKDQALALRWIKENIEAFGGDVSKITLFGESAGGVAVDLHLLTDKDELFNQVIIQSGSAFFAGGIRKPNNRVPIEIASQLGFETDNFAEAIKFLVDQDPHLVVAASTSQRSTLGGNTLRPCLENKYDGVDSFLSDFPENLRARNIPAIYGVNNKEFLTLHAFVTPEDYEVTGIRAFLERAFNLTDSEMEDHVRHFYIGDETLTEKFFDEFIDFASDYYYNYGVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKQYLGITAEGAAHADELGYLLAVDAVPGQHIAEEDQLIIDRITTLWANFAKYGNPTPEPTDLLPVVWTTVEGNKRPYLDIDTDLQLRSRPFHHRMAFWDLFYKLYGELERRN

Summary

Similarity
Belongs to the type-B carboxylesterase/lipase family.
Pfam
PF00135   COesterase
Interpro
IPR002018   CarbesteraseB        + More
IPR019826   Carboxylesterase_B_AS       
IPR029058   AB_hydrolase       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
6EMI     E-value=5.98564e-48,     Score=486

Ontologies

Topology

Length:
1122
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.23161000000002
Exp number, first 60 AAs:
0.12089
Total prob of N-in:
0.10598
outside
1  -  1122
 
 

Population Genetic Test Statistics

Pi
300.675655
Theta
174.535598
Tajima's D
2.394741
CLR
0.705703
CSRT
0.934853257337133
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 YGNPTPEPTDLLPVVWSTVEGNK 95.65 3e-10
28556443 YGNPTPEPTDLLPVVWSTVEGNK 95.65 3e-10
28556443 RPYLDIDTDLQLK 95.65 3e-10
28556443 YGNPTPEPTDLLPVVWSTVEGNK 95.65 3e-10
28556443 VPIEIASQLGFK 95.65 3e-10
28556443 VPIEIASQLGFK 95.65 3e-10
28556443 HFYIGDETLTEK 100.00 2e-04
28556443 AYVTPEDYEVTGIR 100.00 0.010
28556443 ENIEAFGGDVSK 100.00 0.010
28556443 LNVYVSNTATSR 100.00 0.010
28556443 YAPSIPK 100.00 0.010
28556443 RPYLDIDTDLQLR 100.00 0.017
28556443 RPYLDIDTDLQLR 100.00 0.017
28556443 NVYVPNTATSR 100.00 0.017
28556443 RPYLDIDTDLQLR 100.00 0.017
28556443 NIPAIYGVTNK 100.00 0.017
28556443 NIPAIYGVTNK 100.00 0.017
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号