SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05963
Pre Gene Modal
BGIBMGA002901
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.461 PlasmaMembrane   Reliability : 1.518
 

Sequence

CDS
ATGTCGGTGTCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGGTTGACAGAACGGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGAACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCGGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGCCTTCCGGTGGTAATGGAGGTTCGGGAACTTCGCTAGGCGTCATATCACGCCTCCCTTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTATAAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCGTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTGTTCGACCGATATCAAAATCAACGACGGTTGGTGGACGTTCAGCTGGCCAGGCTGTTTGCGATACCCAAACTTTCTCGGGCTTCCGATATCAGAGCCGAGGTACTGAATCCAGTTACGGTGGCCACTAAGGCCTTGGGCAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGATTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAGTCTGCTGGCGTTTTTAGAAGCCGAAAGTCGCCGACACGAGATTATGCCACCACCCTCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCCCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCGCCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCCCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGACGCAGTCATCCAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTCGGCGGCGTGGACCCTCGGAAAGAGGCTTCGCAGGGAGGCGCCGGGTTAGGTACTGCGGGCGGGTGCCAGCGGATGCCCACCAGCTACGCCGGGGTGGCCACGTTGTCCCCCCGTGCGGGGCCGTGTTCGCCTGCTGGATCGAGTAGCCCTGCTCACTCGTCTCCCCCTCCCTCAGAAGTATGGTTTTCTCCTCCGCTGAGGGAGCGGCCGACGCTGGAGCGACTCCCTCCAGTGTTTGGCCCGTTTGGCCATCGTACGCGGAGTGTTGCCCCAGCCCCAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCAGTATTATGTCGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTGAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACACCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACTAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCTTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTGGCGGTTCGTTCTTTGCGGGAGCTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGAAGTTTCAACAGGATCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGACGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTTCCTGATATTAACCACGTGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGTGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCGAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACGATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTGTTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTCTATGCTTGGACAGACAGCCAGATAGTGTTATGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGATCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATGGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACAATGAAGGCTTCTCAGTGGCCACCCTCTCGCATAGGAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCCAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCACTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTGAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGTTGATTCGAGTGGGAGGTAGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCTAAGAAGAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGCTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGAGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCCTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTCTTTGTCTGTCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGTTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGTTAACCACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCGCGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAAAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGTTCATGCATGCACGCCTCATACTCTTCGTCTTCTGATGAGAGGTTCTTCAGCACCGCATCCATCAACAGCGGGAGTCTCGTCACTCGCTGTATCGGTAGCATCAGGAACGAGTGGAGGGATAGACTCTGGCAAGCCGGGTGACTCTCTAGCCTGTGACCGAGTGATAAATATAGCTTTCTCTCGATCTGCGCACATTGCAAGTATGCTGCGATTGGTTGCTCTGTTAGGCTTGTTGTCGGCGGTGGCTGCCCGGTTGAGGGTAGACCCCCTTGTTGATACTCAGCGGGGACTCATCAGGGGACTGAGGTCCGAAAATGGAAAGTTCGCGAAGTTTTTGGGCATACCGTACGCACTAGTTGATGAGAACAATCCTTTCGGGCCATCAGTACCACACCCTGGTTTCGAAGAGACATTCGAAGCATACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTTCAGTGTTTGAACCTGAACGTTTATGTCCCAAACACGGCTACATCGCGCAACAAGCGCCCCGTGATGATTTGGATCCACGGAGGAGGCTTCGCCACCGGCAGTGGGACAGGCAGGGACTTCTCCTACGACGACCTGGTCCGACATGACGTCATCGTCGTATCGGTCAACTACCGACTCGGACCCTACGGGTTCTTATGCTTGGACAGTCCTGATATTCCCGGGAACCAGGGTTTGAAGGATCAAGCTCTTGCTCTCAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGTCTCTAAAATAACCTTGTTCGGAGAGAGTGCTGGTGGCGTCGCTGTCGAGCTACACCTACTGACCGACCAGGATAAACTGTTCAATCAGGTGATCATCCAGAGTGCATCTGCTTTCTTTGCTGGGGGTATTAGGAAACCTAGCAACCGTGTTCCAATAGAAATAGCAAGCCAGCTGGGATTCGAAACTGACAACTTCGTAGAGGCGGTAAAGTTTCTGGCCGGTCAAGACCCCCACCTGGTGGTCGCAGCCAGCACTTCTCAAAGCTCTGCCATAAGAGGCGGTACTCTTAGACCTTGCCGAGAGAACAAATACGACGGAGTTGGCAATTTTCTTTCGGATTTTCCTGAAAATTTAAGGGCTAGAAACATTCCTGCTATTTATGGAGTAACCAATAAAGAATTTCTAACATTACATGCTTATGTGACCCCAGAAGATTACGAGGTGACAGGATTTCGAACTTTTCTGGAACGGGCTTTCAACTTGACCGATAGCGAGATGGAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGCAGTTTGATGAGTTTATAGATTTTGCGTCGGACTATTACTTTAACTACGCCGTCCAGCGGTCTATTAAGAAGTCATTGGCAGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGCAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATTTGGTCCCGGGACAACACATCGCCGAGGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCAAATTTTGCTAAATACAGCAACCCCACCCCTGAGCCGACGGACCTGCTGCCGGTCGTGTGGACGACAGTAGAAGGTAACAAGCGGCCGTATCTGGACATCGACACCGACCTGCAGCTCAGAAGCAGGCCCTTCCACCACCGGATGGCCTTCTGGGATCTCTTCTATAAGCTCTATGGAGAATTGGAGCGCAGGAACTAG
Protein
MSVSYIRGKVTSELRWFASAHALVDRTDRDAALLDRASQVHERLEVVYDRLSDLVALGSEVEKEVIHAIGLDVDQCQEYADAILQRVADIKKQSPSGGNGGSGTSLGVISRLPSIDLPIFHGDLNEWVGFINLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDVQLARLFAIPKLSRASDIRAEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLASLLAFLEAESRRHEIMPPPSSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGPRCAFCHESGHDVAACPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCPNCDGRHHALLCLESAATPRSSGRSHPASPTGERTGRSPRQFGGVDPRKEASQGGAGLGTAGGCQRMPTSYAGVATLSPRAGPCSPAGSSSPAHSSPPPSEVWFSPPLRERPTLERLPPVFGPFGHRTRSVAPAPEAVLLPTASVRVLDSDGNTVFARALLDSGAQGSIMSSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPEVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTKFQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHVSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEMVDHQLWWGPQWLTMKASQWPPSRIGVPPGLVAAPAQFQDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTERPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDKTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPVHACTPHTLRLLMRGSSAPHPSTAGVSSLAVSVASGTSGGIDSGKPGDSLACDRVINIAFSRSAHIASMLRLVALLGLLSAVAARLRVDPLVDTQRGLIRGLRSENGKFAKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMIWIHGGGFATGSGTGRDFSYDDLVRHDVIVVSVNYRLGPYGFLCLDSPDIPGNQGLKDQALALRWIKENIEAFGGDVSKITLFGESAGGVAVELHLLTDQDKLFNQVIIQSASAFFAGGIRKPSNRVPIEIASQLGFETDNFVEAVKFLAGQDPHLVVAASTSQSSAIRGGTLRPCRENKYDGVGNFLSDFPENLRARNIPAIYGVTNKEFLTLHAYVTPEDYEVTGFRTFLERAFNLTDSEMEDHVRHFYIGDETLTEKQFDEFIDFASDYYFNYAVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKQYLGITAEGAAHADELGYLLAVDLVPGQHIAEEDQLIIDRITTLWANFAKYSNPTPEPTDLLPVVWTTVEGNKRPYLDIDTDLQLRSRPFHHRMAFWDLFYKLYGELERRN

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF05585   DUF1758
PF17921   Integrase_H2C2
PF05380   Peptidase_A17
PF18701   DUF5641
PF17917   RT_RNaseH
PF03564   DUF1759
PF00078   RVT_1
Interpro
IPR008737   Peptidase_asp_put        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR000477   RT_dom       
IPR005312   DUF1759       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
6EMI     E-value=3.27101e-42,     Score=439

Ontologies

Topology

Length:
2377
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0464100000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00065
outside
1  -  2377
 
 

Population Genetic Test Statistics

Pi
253.070868
Theta
185.061433
Tajima's D
1.413948
CLR
128.942199
CSRT
0.76111194440278
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号