SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05961  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002901
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.956 PlasmaMembrane   Reliability : 1.288
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCACTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATTAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATAATCTCGCCTTCGATATCGTCGCTCCGCTAATCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTACGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTACCGCTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCACGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTGCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGTGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCTGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCAAAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTCTTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATTTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACGCACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTCGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGCACTAGACGCCTTCAGCTCTAACACCCCGATTACTCTTTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATCCAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAGGCTTAGGGACCCCGTTCATGCATGCACGCCTCATACTCTTCGTCTTCTGATGAGAGGTTCTTCAGCACCGCATCCATCAACAGCGGGAGTCTCGTCACTCGCTGTATCAGTAGCATCAGGACCGAGTGGAGGGATAGACTCTGGCAAGCCGGGTGACTCTCTAGCCTGTGACCGAGTGATAAATATAGCTTTCTCTCGATCTGCGCACATTGCAAGTATGCTGCGATTGGTTGCTCTGTTAGGCTTGTTGTCGGCGGTGGCTGCCCGGTTGAGGGTAGACCCCCTTGTTGATACTCAGCGGGGACTCATCAGGGGACTGAGGTCCGAAAATGGAAAGTTCGCGAAGTTTTTGGGCATACCGTACGCACTAGTTGATGAGAACAATCCTTTCGGGCCATCAGTACCACACCCTGGTTTCGAAGAGACATTCGAAGCATACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTCCAGTGTTTGAACCTGAACGTTTATGTCCCAAACACAGCTACATCGCGCAACAAGCGCCCCGTGATGATTTGGATCCACGGAGGAGGCTTCGCCACCGGCAGTGGGACAGGCAGGGACTTCTCCTTCGACGACCTGGTCCGACATGACGTCATCGTCGTATCGGTCAACTACCGACTCGGACCCTATGGGTTCTTATGCTTGGACAGTCCTGATATTCCCGGGAACCAGGGTTTGAAGGATCAAGCTCTTGCTCTCAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGTCTCTAAAATAACCTTGTTCGGAGAGAGTGCTGGTGGCATCGCTGTCGAGCTACACCTACTGACCGACCAGGATAAACTGTTCAATCAGGTGATCATCCAGAGTGGATCTGTTTTCTTTGCTGGGGGTATTAGGAAACCTAGCAACCGTGTTCCAATAGAAATAGCAAGCCAGCTGGGATTCGAAACTGACAACTTCGTAGAGGCGGTAAAGTTTCTGGCCAGTCAAGACCCCCACCTGGTGGTCGCAGCCAGCACTTCTCAAAGCTCTGCCATAAGAGGCGGTACTCTTAGACCTTGCCGAGAGAACAAATACGACGGAGTTGGCAATTTTCTTTCGGATTTTCCTGAAAATTTAAGGGCTAGAAACATTCCTGCTATTTATGGAGTAAACAATAAAGAATTTCTAACATTACATGCTTATGTGACCCCAGAAGATTACGAGGTGACAGGAATTCGAACTTTTCTGGAACGGGCTTTCAACTTGACCGATAGCGAGATGGAAGATCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGCAGTTCGATGAGTTTATAGATTTTGCGTCGGACTATTACTTTAACTACGGCGTCCAGCGGTCTATTAAGAAGTCATTGGCAGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGCAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATTTGGTCCCGGGACAACACATCGCCGAGGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCAAATTTTGCTAAATACAGCAACCCCACCCCTGAGCCGACGGACCTGCTGCCGGTCGTGTGGACGACAGTAGAAGGTAACAAGCGGCCGTATCTGGACATCGACACCGACCTGCAGCTCAGAAGCAGGCCCTTCCACCACCGGATGGCCTTCTGGGATCTCTTCTATAAGCTCTATGGAGAATTGGAACGCAGGAACTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDNLAFDIVAPLIPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPLSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLTAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDVLPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLKAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLALDAFSSNTPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDPVHACTPHTLRLLMRGSSAPHPSTAGVSSLAVSVASGPSGGIDSGKPGDSLACDRVINIAFSRSAHIASMLRLVALLGLLSAVAARLRVDPLVDTQRGLIRGLRSENGKFAKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMIWIHGGGFATGSGTGRDFSFDDLVRHDVIVVSVNYRLGPYGFLCLDSPDIPGNQGLKDQALALRWIKENIEAFGGDVSKITLFGESAGGIAVELHLLTDQDKLFNQVIIQSGSVFFAGGIRKPSNRVPIEIASQLGFETDNFVEAVKFLASQDPHLVVAASTSQSSAIRGGTLRPCRENKYDGVGNFLSDFPENLRARNIPAIYGVNNKEFLTLHAYVTPEDYEVTGIRTFLERAFNLTDSEMEDHVRHFYIGDETLTEKQFDEFIDFASDYYFNYGVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKQYLGITAEGAAHADELGYLLAVDLVPGQHIAEEDQLIIDRITTLWANFAKYSNPTPEPTDLLPVVWTTVEGNKRPYLDIDTDLQLRSRPFHHRMAFWDLFYKLYGELERRN

Summary

Uniprot
ProteinModelPortal
PDB
6EMI     E-value=1.08046e-43,     Score=451

Ontologies

Topology

Length:
1688
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.50141000000001
Exp number, first 60 AAs:
0.05477
Total prob of N-in:
0.03424
outside
1  -  1688
 
 

Population Genetic Test Statistics

Pi
172.988251
Theta
160.215655
Tajima's D
2.039794
CLR
136.581914
CSRT
0.885555722213889
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 HFYIGDETLTEK 100.00 3e-05
28556443 AYVTPEDYEVTGIR 100.00 0.005
28556443 ENIEAFGGDVSK 100.00 0.005
28556443 LNVYVSNTATSR 100.00 0.005
28556443 YAPSIPK 100.00 0.005
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号