SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05959  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002902
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.252 Nuclear   Reliability : 1.618
 

Sequence

CDS
ATGGGCACAAAACAACTTAATGTCATCCAAAGGGGCATCGCTCAAAAACTTTGTAAGGCATATCGCACGGTCTCCCTGAACTCGGCACTGTTAATGGCTGGGATATTCCCTTTGGATCTCCGAGTTCGAGAGGCAGCCTCTCTATATGAGGCCAAGAAGGGAGTATGCCAGTCATGGCTTGGGGACAGGGAGATCGAGCGAATGTCATCAGCAATGAACGCCCCTCATCCCGCAGAGCAACTGAGTCTGGAGTTTGGCAATCTGGTAGACGAGGAACAATATAACACCCTCAACCACCTTGATGTGAGAATCTTCACGGATGGGAGCAAGATTGAGGGCCGAGTTGGGGCCGCTTTATCCATTTGGGATGGTGAGGCCGAAATATGGTCCCACAAGCTTGCTCTCGCACCCTATTGCACCGTTTATCAGGCCGAACTTTTGGCTCTAAATTATGCAGTCAAAGAAGCCCAGCTCCGAAACGGGTCTACTTTTGGAGTCTTTAGCGACAGCAAAGCGGCATTCCTCACAGTCACTAATCACGGTTCCCTCCATCCACTAGCCGTAGACACCAGAAACATGCTGAAACAATGCACATTGCAAAATAAGACCGTTGCCCTATATTGGATAAAATCACACGCGGGGTTGGAGGGAAACGAGCGAGCAGATCAACTTGCTAAGGAAGCCGCTCTGCTGTCGAAAATGACAGACAGGCAGAACATTACGACCTGTCCAGTGCATGCATGCATGCCTCATACTCTTCGCCTTCTGAGGAGAGGTTCTTCAGCACCGCATCCATCAAGAGCGGGAGTCTCGTCACTCGCTGCATCGGTAGCATCAGGAACGAGTGGAGGGATAGACTCTGACAAGCCGGGTGACTCTCTAGCCTGTGACCGAGTGATAAATATAGCTTTCTCTTTCTCTCGATCTGCGCACATAATCGCTTCGGCCAATTTAGTGTTACCGACGCAGGGGCCTCGCCGCAAGGCGAGCGCGTGTTTAAGTCCCGGGGCAGCCCCCCCTGGGCAGTCCGAAGAAATGGAGTTTTCTCCAACCAACACACTGCTCGCGGAATTCTTAAGCGAGAAATACCCGGCCCTCGAATCAGAATTTTTAGCTTACAAAGCTAAACGCGCCGTGAACTGTTCTGCCGTGCCCGCCGCGCCCGCCGTTTCCGCCACGCCTGCCGTTCCCGCGTCCCCTGCAAGCGCGCGCAAAACTCCCGCGCCGTACACCGCAGCCTCCGTCGCGCCCAGCACACCCGTGTCCCCCATACTGTCGCGAAAAACTCCCGCGTCTACCGCGGCAGCTTCCGTTCTACCTCAGCGATCGTCTGCGGCCTCCGTCGCGTCCGCCGCTCCCACGCCTTCCTCCTCGTCCTCCGACTCTGACTCGGATATGGAGGTTGACCTCGTTCCCGCCTCATTAACAGATGGATTCACTCTCGTGCAAAAGGGTAAGAAGCGCGCCGCGGAGTCCCGAGCTTCCGCGGCCGCTAAAATAAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCCGACCCCTGTCGCTCCCTGTCCCCGTGCCACGCCGTCGCCGCGCCCGGTGGCACAAACGAGAAATCAGGCCCCTCCTCCGTTGATTCTTCAAGAGAAGGCTGCTTGGGACCGTATCTCCCTGGCCCTTAAGGCCAAAAACATAAATTTTGTCAGTGCCCGTAACCTCGCGAACGGGATACAGATAAAAGTAGCAACACCCGACGACCATAGGGCCCTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTATCATACGTATACGCTCCAGGAGGAGCGTGAGCTCCGTGCAGTCATACGTGGCATCCCCAAGGAGTTAGATGCCGAGCTCGTAAAGGCCGACCTACTCGAACAAGGCCTACCCGTAAACTCCGTGCACCGCATGCACACAGGACGCGGGAGGGAGCCATATAATATGGTTCTCGTCGCCCTCCAGTCTACCCCCGAGGGATTTTTTAACGCTTACGGTCTCGCAAATCAACGTGATCAGGTTTGTGATTTTTTGCGTGACCATCAAATTGACATCTTTTTGGTGCAGGAGACCCTGCTTAAGCCCGCGCGCCGCGACCCTAAAATCGCGAACTATAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGACGAGCCCTGCACTGCGTCCCACTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATCTCACTGACTGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACGTCAGGTGGAACTCACACACCACAACACCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCATCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGATTGTGGTGGATTGGCACACGCTGGGCATCAGCTTGGCTGAATCTGATCCACCATTGCTCCCGTTGAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGCGCCTACGATAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCATAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGATGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTTGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTTTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGATTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCTAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGAGCAGGCTTAGGAACCGTAACGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAACCCATGCATCAGCCCGCTGAGTTTCTCGCCGGATCTTCTCAGCGGTGCAAGTATGCTGCGATTGGTTGCTCTTTTGGGCTTGTTGTCAGCAGTGGCTGCCCGGTTGAGGATAGACCCGCTTGTTGATACTCAGCGGGGCCTCATCAGGGGACTGAGGTCCGAAAATGGAAAGTTCTCGAAGTTTTTGGGCATACCGTACGCACTAGTCGACGAGAACAATCCTTTCGGGCCATCAGTACCACACCCTGGTTTCGAAGAGACATTCGAAGCATACGATGATTCCGTAGTTTGTCCTCAAGTTACTAAGGGCGTCGGAGTTGGTAGTCTCCAGTGTTTGAACCTGAACGTTTATGTCCCAAACACGGCTACATCGCGCAACAAGCGCCCCGTGATGGTTTGGATCCACGGAGGAGGCTTCACTAGCGGCAGCGGGACAGGCAGGGACTACTCCTTCGACGACCTGGTCCGACATGACGTCATCGTCGTATCGGTCAGCTACCGACTCGGACTCTATGGGTTCTTATGTTTGGACAGTCCTGATTTTCCCGGCAACCAGGGTATGAAGGACCAAGTTCTTGCTTTGAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGCCTCTAAAATAACCTTATTCGGAGAGAGTGCTGGCGGCGTCGCTGTCGAGCTACACCTACTGACCGACCAGGATAAGCTGTTCAATCAGGTGATCATCCAGAGTGGATCTGCTTTCTTTGCTGGGGGTATTAGGAAACCTAGCAGCCGTGTTCCAATAGAAATAGCGAGCCAGCTGGGATTCGAAACTGACAACTTCTTAGAGGCGGTAAAGTTTCTGGCCGATCAAGACCCCCACCTGGTGGTTGCAGCCAGCACTTCTCAAAGCTCTACCTTAAGAGGCGGTACTCTTAGACCTTGCTTAGAAAACAAATACGACGGAGTTGACAGTTTTCTTTCCGACTTTCCTGAAAATTTAGAGGCTAGAAACATTCCTGCTATTTATGGAGTAACCAATAAAGAATTTCTAACATTACATGCTTATGTGACCCCCGAAGACTACGAGGTGACAGGAATTCGAGCTTTTCTGGAACGGGCTTTCAACTTGACCGATAACGATATGGAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGAAGCAGTTCGATGAGTTTATAGATTTTGCATCAGACTATTACTTCAACTACGCCGTCCAGCGGTCTATAAAGAAGTCATTGGCCGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGGAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATGCGGTCCCGGGACAGCACATCGCCGAGGAGGACCAACTGATCATCGACAGGATCACTACTCTTTGGGCTAATTTTGCCAAATACGGTAACCCCACCCCTGAGCCGACGGACCTGCTGCCGGTCGTGTGGTCGACAGTAGAAGGTAACAAGCGGCCGTATCTGGACATCGACACCGACCTGCAGCTCAGAAGCAGGCCCTTCCACCACCGGATGGCCTTCTGGGATCTCTTCTATAAGCTCTATGGAGAATTGGAACGCAAGAAATAA
Protein
MGTKQLNVIQRGIAQKLCKAYRTVSLNSALLMAGIFPLDLRVREAASLYEAKKGVCQSWLGDREIERMSSAMNAPHPAEQLSLEFGNLVDEEQYNTLNHLDVRIFTDGSKIEGRVGAALSIWDGEAEIWSHKLALAPYCTVYQAELLALNYAVKEAQLRNGSTFGVFSDSKAAFLTVTNHGSLHPLAVDTRNMLKQCTLQNKTVALYWIKSHAGLEGNERADQLAKEAALLSKMTDRQNITTCPVHACMPHTLRLLRRGSSAPHPSRAGVSSLAASVASGTSGGIDSDKPGDSLACDRVINIAFSFSRSAHIIASANLVLPTQGPRRKASACLSPGAAPPGQSEEMEFSPTNTLLAEFLSEKYPALESEFLAYKAKRAVNCSAVPAAPAVSATPAVPASPASARKTPAPYTAASVAPSTPVSPILSRKTPASTAAASVLPQRSSAASVASAAPTPSSSSSDSDSDMEVDLVPASLTDGFTLVQKGKKRAAESRASAAAKISKAANASRPRPPTPVAPCPRATPSPRPVAQTRNQAPPPLILQEKAAWDRISLALKAKNINFVSARNLANGIQIKVATPDDHRALSSYLRKERISYHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQSTPEGFFNAYGLANQRDQVCDFLRDHQIDIFLVQETLLKPARRDPKIANYNMVRNDRLTARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHVRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRIVVDWHTLGISLAESDPPLLPLSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSDFLERLAPSQRSYYRLARTLKSDTVVTMPPLIGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGINRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRNRNVTVLVELDKEVDVQPNPCISPLSFSPDLLSGASMLRLVALLGLLSAVAARLRIDPLVDTQRGLIRGLRSENGKFSKFLGIPYALVDENNPFGPSVPHPGFEETFEAYDDSVVCPQVTKGVGVGSLQCLNLNVYVPNTATSRNKRPVMVWIHGGGFTSGSGTGRDYSFDDLVRHDVIVVSVSYRLGLYGFLCLDSPDFPGNQGMKDQVLALRWIKENIEAFGGDASKITLFGESAGGVAVELHLLTDQDKLFNQVIIQSGSAFFAGGIRKPSSRVPIEIASQLGFETDNFLEAVKFLADQDPHLVVAASTSQSSTLRGGTLRPCLENKYDGVDSFLSDFPENLEARNIPAIYGVTNKEFLTLHAYVTPEDYEVTGIRAFLERAFNLTDNDMEDHVRHFYIGDETLTEKQFDEFIDFASDYYFNYAVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKEYLGITAEGAAHADELGYLLAVDAVPGQHIAEEDQLIIDRITTLWANFAKYGNPTPEPTDLLPVVWSTVEGNKRPYLDIDTDLQLRSRPFHHRMAFWDLFYKLYGELERKK

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
2158
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.12258999999995
Exp number, first 60 AAs:
6.36317
Total prob of N-in:
0.32741
outside
1  -  2158
 
 

Population Genetic Test Statistics

Pi
153.231864
Theta
147.408706
Tajima's D
0.497142
CLR
0.592812
CSRT
0.516274186290685
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 YGNPTPEPTDLLPVVWSTVEGNK 100.00 4e-10
28556443 YGNPTPEPTDLLPVVWSTVEGNK 100.00 4e-10
28556443 RPYLDIDTDLQLK 100.00 4e-10
28556443 YGNPTPEPTDLLPVVWSTVEGNK 100.00 4e-10
28556443 VPIEIASQLGFK 100.00 4e-10
28556443 VPIEIASQLGFK 100.00 4e-10
28556443 ENIEAFGGDASK 100.00 3e-07
28556443 ENIEAFGGDASK 100.00 3e-07
28556443 AYVTPEDYEVTGIR 100.00 0.007
28556443 ENIEAFGGDVSK 100.00 0.007
28556443 LNVYVSNTATSR 100.00 0.007
28556443 YAPSIPK 100.00 0.007
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号