SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05957  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002902
Annotation
PREDICTED:_esterase_FE4-like_[Bombyx_mori]
Full name
Carboxylic ester hydrolase      
Location in the cell
Cytoplasmic   Reliability : 1.158
 

Sequence

CDS
ATGCTGCGATTGGTTGCTCTTTTGGGCTTGTTGTCGGCGGTGGCTGCCCGGTTGAGGATAGACCCGCTTGTTGATACTCAGCGGGGCCTCATCAGGGGACTGAGGTCCGAAAATGGAAAGTTCTCGAAGTTTTTGGGCATACCGTACGCACTAGTCGACGAGGACAATCCTTTCGGGCCATCAGTACCACACCCTGGTTTCGAAGAGACATTCGAAGCGTACGATGATTCCGTAGTTTGTCCTCAAGTTACTAATAACGTCGGAGTTGGTAGTCTCCAGTGTTTGAACCTGAACGTTTATGTCTCAAACACGGCTACATCGCGCAACAAGCGCCCCGTGATGGTTTGGATCCACGGAGGAGGATACACTAGCGGCAGCGGGACAGAGCGGGACTACTCCTTCGACGACCTGGTCCGACATGACGTCATCGTCGTATCGGTCAGCTACCGACTCGGACTCTATGGGTTCTTATGTTTGGACAGTCCTGATTTTCCCGGCAACCAGGGTATGAAGGATCAAGTTCTTGCTTTGAGATGGATTAAGGAAAATATCGAAGCGTTCGGCGGAGATGCCTCTAAAATAACCTTATTTGGAGAAAGTGCTGGCGGCGCCGCTGTCGAGCTACACCTACTGACCGACCAGGATAAGCTGTTCAATCAGGTGATCATTCAGAGTGGATCTGCTTTCTTTCCTGGGGGTATTGGGCAACCTAGAAACCGTGTTCCAATAGAAATAGCAAGCCAGCTGGGATTCAAAACTGACAACTTCTTAGAGGCGGTAAAGTTTCTGGCCGATCAAGACCCCCACCTGGTGGTTGCAGCCAGCACTTCTCAAAGCTCTACCTTAAGAGGCGGTACACTCAAACCTTGCAGAGAAAACAAATACGACGGAGTTGACAGTTTTCTTTCCGACTTTCCTGAAAATTTAGAGGCTAGAAACATTCCTGCTATTTATGGAGTAACCAATAAAGAATTTCTAACATTACATGCTTATGTGACCCCAGAAGACTACGAGGTGACAGGAATTCGAACTTTTCTGGAACGGGCTTTCAACTTGACTGATAACGAGATGAAAGACCACGTGAGACATTTCTACATCGGAGACGAGACGCTGACCGAGGAGTTTTTCGATGAGTTTATAGATTTTGCGTCGGACTATTACTTCAACTACGCCGTCCAACGGTCTATAAAGAAGTCATTGGCCGACGGTAACAAGGAGGTATATTACTACGTGTTCTCGTACGACGGAGGCAGGAATGCCATGAAGGAGTACCTCGGCATAACGGCGGAGGGCGCTGCGCACGCGGACGAGCTCGGCTACCTGCTGGCCGTGGATGCGGTCCCGGGACAACACATCGCCGAGGAGGACCAACTGATCATCGATAGGATCACTACTCTTTGGGCTAATTTTGCTAAATACGGCAACCCCACCCCTGAGCCGACGGACCTGCTGCCGGTCGTGTGGTCGACAGTAGAAGGTAACAAGCGGCCGTATCTGGACATCGATACCGACCTGCAGCTCAGAAGCAGGCCCTTCCACTACCGGATGGCCTTCTGGGATCTCTTGTATAAGCTCTATGGAGAATTGGAGCGCAAGAACTAA
Protein
MLRLVALLGLLSAVAARLRIDPLVDTQRGLIRGLRSENGKFSKFLGIPYALVDEDNPFGPSVPHPGFEETFEAYDDSVVCPQVTNNVGVGSLQCLNLNVYVSNTATSRNKRPVMVWIHGGGYTSGSGTERDYSFDDLVRHDVIVVSVSYRLGLYGFLCLDSPDFPGNQGMKDQVLALRWIKENIEAFGGDASKITLFGESAGGAAVELHLLTDQDKLFNQVIIQSGSAFFPGGIGQPRNRVPIEIASQLGFKTDNFLEAVKFLADQDPHLVVAASTSQSSTLRGGTLKPCRENKYDGVDSFLSDFPENLEARNIPAIYGVTNKEFLTLHAYVTPEDYEVTGIRTFLERAFNLTDNEMKDHVRHFYIGDETLTEEFFDEFIDFASDYYFNYAVQRSIKKSLADGNKEVYYYVFSYDGGRNAMKEYLGITAEGAAHADELGYLLAVDAVPGQHIAEEDQLIIDRITTLWANFAKYGNPTPEPTDLLPVVWSTVEGNKRPYLDIDTDLQLRSRPFHYRMAFWDLLYKLYGELERKN

Summary

Similarity
Belongs to the type-B carboxylesterase/lipase family.
Feature
chain  Carboxylic ester hydrolase
EC Number
3.1.1.-
EMBL
BABH01018995    BABH01018991    BABH01018992    BABH01019018    BABH01018984    BABH01018985    + More
NWSH01000660    PCG74962.1    ODYU01001845    SOQ38611.1    SOQ38612.1    KZ149903    PZC78410.1    KQ460400    KPJ14974.1    KQ459564    KPI99621.1    NWSH01000356    PCG77070.1    KQ459606    KPI91074.1    KY021858    AQY62747.1    KZ150007    PZC75160.1    SOQ38608.1    BABH01021273    PCG77069.1    FJ997304    ADF43469.1    SOQ38610.1    SOQ38609.1    KY021842    AQY62731.1    SOQ38607.1    FJ997307    ADF43472.1    BABH01001500    KY304479    AUN86410.1    SOQ38604.1    BABH01007753    ODYU01001525    SOQ37859.1    NWSH01000067    PCG79999.1    EU523536    ACB12415.1    KC200270    AGG20205.1    KPI91073.1    KPI99620.1    KQ459837    KPJ19757.1    KPI99618.1    KPI91075.1    SOQ38605.1    ODYU01010533    SOQ55708.1    EU523532    ACB12411.1    JTDY01003780    KOB69017.1    AGBW02008309    OWR53771.1    JTDY01001549    KOB73566.1    KPJ19760.1    KPI99616.1    PZC78409.1    KY021841    AQY62730.1    PCG74961.1    FJ997305    ADF43470.1    FJ997306    ADF43471.1    KQ460205    KPJ17125.1    NWSH01000834    PCG73942.1    OWR53772.1    MG846884    AXY94736.1    KY021848    AQY62737.1    PZC78414.1    PZC78412.1    KZ150132    PZC73036.1    PZC78411.1    SOQ37858.1    ODYU01008680    SOQ52463.1    PCG74959.1    PCG74960.1    KJ023212    AIY69040.1    SOQ38606.1    KY021850    AQY62739.1    EU688968    ACD80422.1    NWSH01001418    PCG71299.1    RSAL01000258    RVE43396.1    JTDY01003106    KOB70142.1    KQ460947    KPJ10567.1    SOQ38613.1    RVE43394.1    OWR53773.1    ODYU01006598    SOQ48575.1    KPI91162.1    BABH01001182    KC200271    AGG20206.1    FJ652455    ACV60239.1    KU375432    APD13874.1    BABH01003066    FJ556877    ACL83460.1    DQ680829    ABH01082.1    EU523534    ACB12413.2    KY021887    AQY62776.1    KP001149    AJN91194.1    KY021884    AQY62773.1    LC017770    BAR64784.1    JTDY01004572    KOB67996.1    JTDY01003509    KOB69443.1    AGBW02011630    OWR46387.1    ODYU01002878    SOQ40908.1    FJ997308    ADF43473.1    NWSH01002285    PCG68674.1    KZ150117    PZC73246.1    KZ149946    PZC76749.1    KY021873    AQY62762.1    PZC73247.1    MF687628    ATJ44554.1    JX306730    AFO65061.1    MF687561    ATJ44487.1    NWSH01000400    PCG76673.1   
Pfam
PF00135   COesterase
Interpro
IPR002018   CarbesteraseB        + More
IPR019826   Carboxylesterase_B_AS       
IPR029058   AB_hydrolase       
IPR002168   Lipase_GDXG_HIS_AS       
IPR000997   Cholinesterase       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
5TYM     E-value=5.28412e-46,     Score=466

Ontologies

Topology

SignalP
Position:   1 - 16,         Likelihood:  0.968814
 
 
Length:
533
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0338800000000002
Exp number, first 60 AAs:
0.03207
Total prob of N-in:
0.00187
outside
1  -  533
 
 

Population Genetic Test Statistics

Pi
293.870978
Theta
174.582849
Tajima's D
2.186018
CLR
0.00059
CSRT
0.911304434778261
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 YGNPTPEPTDLLPVVWSTVEGNK 100.00 6e-10
28556443 YGNPTPEPTDLLPVVWSTVEGNK 100.00 6e-10
28556443 RPYLDIDTDLQLK 100.00 6e-10
28556443 YGNPTPEPTDLLPVVWSTVEGNK 100.00 6e-10
28556443 VPIEIASQLGFK 100.00 6e-10
28556443 VPIEIASQLGFK 100.00 6e-10
28556443 ITTLWANFAK 100.00 2e-09
28556443 ITTLWANFAK 100.00 2e-09
28556443 ENIEAFGGDASK 100.00 1e-08
28556443 ENIEAFGGDASK 100.00 1e-08
28556443 AYVTPEDYEVTGIR 100.00 0.005
28556443 ENIEAFGGDVSK 100.00 0.005
28556443 LNVYVSNTATSR 100.00 0.005
28556443 YAPSIPK 100.00 0.005
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号