SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05938
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.861
 

Sequence

CDS
ATGGGGAACGGGGGCTTCTGCCTTTACTGGTCGAAGCCGCGAGGATGCAAACCTCTTCAAAAATGCCCTAATCCCAAGCTCGACACCCGGCGATGGGATGATGAAGGGGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGTGTTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTATAATCAGTCCCACCAAACCATCGGCGGGGAAAAAGAGGGGGAGAAGAAAGACGGCACTACCAATTTCCGATGACAGCTGCGCGTCATCCTCCGGCACTGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGACTCCGGTGGTTCCGGGGCCTGCTACGTCGGAAGACGCGATGCCCGCTCCCCAGTGGGTACCAGTGAGGAGGAGGGGCGCTGTGTCACCAGCGACGTCCGTGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCACTGGTCAACTTGGGCAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAACGGCTCCGGGAGGCAGCCGCTATGGTGAGAACAAGGCTGATCCCCACCATGTCCAAGCTTTATGACTTGGTAGAGAGCCGAGAGGTGGAGAGCAAAGATCTTGTCGCTCATTGTGACTCCAGAGAGAGTCGCATCTCGGGAGATACCCCGGCCTTGCGGGGAGGGACTCCCCTGTTGCCGAGGCCGCCGCTGGCACGCTCTGGCCCCCCCGCGGGGGCGATGGATATTGACGTGCAATTGCGTTCCGCTGTGAGTGTGACGGCGCAAATGCCAGAGCCCAATCCTGTGGCCCCTGTCCCGCTAGCGCCTAGCCCCGCGCTCCCTCGCCCTCCACGTAGGGTCGAGTTAAGGCCTGCGCCGCCTCCGCGGATATCGGCCGCCCCTGCGTCTACACGGAGAGGAAGGCTAAGCCCTGCGCCAGCGCGGGCTGAAGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCGGCGCTACCGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTTGCAGGCTCGCGGGCCACACAACACGGCTGCTGGGATGGTAGAGGTGGACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGTATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGTTCCTCGATTGGTTCCGGAGACTGCATCCCGGCGCCAACAGCCGCAGCCACCCCGCGGAGCCAGGCCGCCCGGCCGACCTCTATCCCCACTCCATCCGCGAGGTTGGCACGGCGTAGAGGCCGGGACCAAAACAACAAGGGTACGGGTGCCCAGAATCCTGCCCCAAAATCCCAACCCCGTCCCCTTCCTGCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGCAAGGCAGCAGACAGCGGCTCTGGCAGCTCCCAGAGGGGGTCGAGCGCCGACCGCTGCAGCACGAAGCACAGAGCTGGCGGCCGTAGCTGCTCCTCGTGAGAATCGAGCACTGGCAGCCAGGAAGAAGAATGGCAAAAAGAAGAGGCCGCGCGCAGCGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCGGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCGGGCGCGCGCGGCCGTAAGTTTGGATGAAATCGGGGCAGAGGAGGGCCTCCGCTTCCGGCACACAGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCACTGCCGGAGGATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGAATCACCGGCCTGGACGACTGTGCTACCAAGGAGGAGGTGGCAGCCGCGATAGCCGCCCAAGGTGGATGTGCCCTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCTGGAGCCAGGTCGGTGTGGGCGCGCTGCCCTGTGGAGGCAGCCACTTCCTTGGCCACTCCTCCGCCGGGAAGATCGACGGGGGACCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCTATGTCTCCGATGTTTTAGCACCGGGCACGGCCTCGCTAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCACAGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGCCGAAAATCAAAGCGCCGACAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGATGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGTGAAGGGGAGGGGGCGATGGATGTGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATATGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGTTGGTTTGGGGACGACGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTAATGGAGAGGTGGGCGCACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGCGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTAGACTCCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCATTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAAAAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTTTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCCCCACATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAAGACACTGCACCCGGCCCGGACGGCGTGCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCTCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGGCACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCATTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGCTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCGTGGCGCGTCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAGTAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATTTCGCCCAAGCCCTGGCCCTCTAA
Protein
MGNGGFCLYWSKPRGCKPLQKCPNPKLDTRRWDDEGGCATGSGIPVEPRCSPIAGSMRSALASDSGIISPTKPSAGKKRGRRKTALPISDDSCASSSGTEVPEKTMAIEEVTPVVPGPATSEDAMPAPQWVPVRRRGAVSPATSVESMSTSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVRTRLIPTMSKLYDLVESREVESKDLVAHCDSRESRISGDTPALRGGTPLLPRPPLARSGPPAGAMDIDVQLRSAVSVTAQMPEPNPVAPVPLAPSPALPRPPRRVELRPAPPPRISAAPASTRRGRLSPAPARAEDIRSPLARMVDEWPALPPPLSPSRAAGLQARGPHNTAAGMVEVDSLPSREEMVACISRAVAVEVGKHFAGLEEMLRSSIGSGDCIPAPTAAATPRSQAARPTSIPTPSARLARRRGRDQNNKGTGAQNPAPKSQPRPLPAPPSSMDEGWTEVVKRGKKARQQTAALAAPRGGRAPTAAARSTELAAVAAPRENRALAARKKNGKKKRPRAARSAAVVVTLLPAAAEKGLTYNEVMARARAAVSLDEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEDEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSVWARCPVEAATSLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWLCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGDNTERNRRRKSKRRQKRRLARGALANAVIPDAAPVPEGGGSGEGEGAMDVDMLSQSMAEWSIDMAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLMERWAHAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKALLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRKKMRPWAPPITERLQPQQLRDIVSALFPQEREGFFAPAMDAPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWAPESATCRCPYRGWRRPDWGRGAVEVPRPHSGQSLDLPCSFSAPGPSFVGGGRRVKPASAQRRGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWALEAEALAADYQWRADLRARGVARPSHSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKVGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADFAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=1.91903e-10,     Score=164

Ontologies

Topology

Length:
1820
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0374900000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1820
 
 

Population Genetic Test Statistics

Pi
10.727323
Theta
133.793131
Tajima's D
2.786572
CLR
187.809661
CSRT
0.967651617419129
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号