SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05934
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.484 Nuclear   Reliability : 2.045
 

Sequence

CDS
ATGGACGTATTTATATCTATTGTATTCGATGGTAACCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAGTCTTCTTGGGATCGCGTGTCCCTGGCCCTTAAGGCCCAAAAGATCAATGTCGTCCATGCGAGGAATATCCCGCATGGAATTCAGATCAAGGTAGAAACATCCGACGACCATAGGTCGTTGACCGCGTACCTCCGCAAGGAACGCATAGGGTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCCAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGTACAGCGGGCGCGACAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGTGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAACTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAGTGCTTAGACGATCACGCGACCATCGATTGCTCGCGCGTTAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCGCCCGCACCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCACTCAAACGACTTTACAATTATTCGCGACTACATCGCCGCGATAAACATTGACCGCATGCGTGCATTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGGTTTGA
Protein
MDVFISIVFDGNRKVPAPPPVILREKSSWDRVSLALKAQKINVVHARNIPHGIQIKVETSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMYSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATIDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPAPGPAPRPGPAHSNDFTIIRDYIAAINIDRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQRTLV

Summary

Uniprot
Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       
ProteinModelPortal

Ontologies

GO

Topology

Length:
372
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00019
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00309
outside
1  -  372
 
 

Population Genetic Test Statistics

Pi
203.80295
Theta
59.931303
Tajima's D
3.089767
CLR
31.577171
CSRT
0.982900854957252
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号