SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05887
Pre Gene Modal
BGIBMGA013332
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.111 Nuclear   Reliability : 1.962
 

Sequence

CDS
ATGCAGCTCGGTCGCCCTCACAACCCAGCCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGAAGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACTGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGTGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGGGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGATACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATCTCCACGATGACCTGGAGCTTGACTCTGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGATGAATGTACTGCAAAGTAGTTTGTCAGACTTGTCGGAGCACTTTTACAAGAAGATGGCTGATTTTGAGGCAAAGCTTCATCCACAGTCAGTATCATCTCCCTCAACATCTTCTCCGGACCTGGCTGCTGAGTTTGCAGTGTTTCGAGCATTTATCACTGAGGCTGTGTCGGGTCTACAAAAACAGATTGAGGTTCTGTCTCACAAACTTGATCACATGGAGATGCATGGCCGCAGGAAGATGTTGCTTTTCCACGGGGTGGTTGAACAGAAACAAGAAAATACATTCGAAATTGTGGCCGACATATTGAAAAAACATTTTTCATTAAATACTGTTTCAGTTCACGATATTAAATGGTGTAACAGAATGAGACAGCCTTCTGCCAGGGAAAGGGCACGACCGATCTTGGTGAAGTTCCATGATTTTAGTTTCCGCAATAAGATCTGGTTTAGTAAGTCTCAATTAAAAAGGACTGGGATAACGGTTTCCGAATTTCTTACGAAACAACGGCACGATGTTTTCATGGCAGCACGGGACAAGTTTGGAGTAACGAACTCGTGGACTAAAGAAGGCACAGTTTATGTTCTCGGCTCAGATGGCAAAAGACATCGGGTGTACTGCCGTAGACAACTGATTGAAATTGATAGGCACACCGTGGAGACTGTTCCTGTACAAACTGCCGCAAAACCAAACACGGCGTCTGTTGCACCAAAGCTTAAGCGTGCGGCCGCCCGTAAATGA
Protein
MQLGRPHNPATVTRTMVDWNKLGTCLAEAAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNWIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVGGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTIRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMMNVLQSSLSDLSEHFYKKMADFEAKLHPQSVSSPSTSSPDLAAEFAVFRAFITEAVSGLQKQIEVLSHKLDHMEMHGRRKMLLFHGVVEQKQENTFEIVADILKKHFSLNTVSVHDIKWCNRMRQPSARERARPILVKFHDFSFRNKIWFSKSQLKRTGITVSEFLTKQRHDVFMAARDKFGVTNSWTKEGTVYVLGSDGKRHRVYCRRQLIEIDRHTVETVPVQTAAKPNTASVAPKLKRAAARK

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0133543,     Score=94

Ontologies

Topology

Length:
937
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.704949999999998
Exp number, first 60 AAs:
0.00039
Total prob of N-in:
0.02570
outside
1  -  937
 
 

Population Genetic Test Statistics

Pi
128.030844
Theta
138.289503
Tajima's D
2.127303
CLR
184.838951
CSRT
0.905704714764262
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号