SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05879
Pre Gene Modal
BGIBMGA002937
Annotation
PREDICTED:_nitric_oxide_synthase-like_protein_isoform_X1_[Bombyx_mori]
Full name
Nitric oxide synthase-like protein       + More
Nitric oxide synthase      
Nitric oxide synthase, salivary gland      
Alternative Name
Inducible nitric oxide synthase-like protein
dNOS
Location in the cell
Cytoplasmic   Reliability : 1.854
 

Sequence

CDS
ATGTTCGAAGCACTCTGTAACCACATCAAGTACAGCACAAATAAAGGAAATATAAGATCAGCTATAACATTGTTCCCACAACGTACGGACGGCAAGCACGACTACAGAATATGGAACAGCCAGCTGATCAGCTACGCTGGCTACCGTCAGCCAGACGGTACGGTGCTTGGTGACCCCATGCACTGCGAATTCACTGATCTCTGCTTGAAACTTGGCTGGAAGCCGCCACGCACGGCCTGGGATATTCTTCCCCTAGTTCTGTCAGCTAACGGGAAAGACCCTGACTACTTCGAAATCCCCAGGGAGCTTGTTATGGAAATCCACATGACGCACCCCACGTTCGAATGGTTCAAAGAACTAGAATTACGTTGGTACGCTTTGCCCGCCGTCTCCAGTATGCGTTTTGATTGCGGTGGCATCGAATTCACGGCCAACGCTTTCAACGGTTGGTACATGAGCACTGAAATCGGCTGCAGGAACTTCTGTGACACCAACCGGCTTAATGTTTTGGAGAAAATAGCTCAAAACATGGGCCTAGATACCAGAACTCCGGTCAATCTTTGGAAGGATAAGGCCCTCGTGGAAGTGAACGTGGCTGTACTGCACAGCTTTCAACAGCACAACGCGACTATCGTGGATCATCATACAGCTTCTGAAAGCTTCATAAAGCATTTGGATAACGAGAACCGGCTTCGGTCTGGATGTCCAGCCGATTGGATATGGATCGTACCTCCCATGTCATCGTCCATAACCCCGGTGTTTCACCAAGAAATGGCGCTCTACTACTTGAAACCTTCATACGAATATCAGGAGCCTGCATGGAAGACGCATCAGTGGCAGAAATCTAAGCCGATCACAGGCAAAAGACCCATAAACAGAAAGTTCCATTTCAAGCAAATTGCCCGAGCTGTCAAATTCACTTCGAAATTGTTCGGTCGTGCCCTTTCGAAGAGGATTAAAGCGACTGTGCTGTACGCTACGGAGACTGGGAAATCGGAACAATACGCCAAAGAGCTTGGTGTTATATTTGGACACGCCTTTAATGCGCAGGTTCATTGTATGGCGGATTACGATATAACTTCAATTGAACACGAAGCTCTCCTTCTGGTTGTGACATCGACGTTTGGAAATGGTGACCCACCCGAGAATGGTGTCGCATTTGGAGAGCATCTATGCGAAATATTATACGCTGATCAAGTCGGTGAAGATTCTACTGGAAATCAAATGTTGACACCAAAATCGTTCATAAAAGCCAATAGTGACATTCAAAGGTATACAGCAGGAAATCCGAAAAAACTCAACAGACTCGAATCATTGAAGGGTAGTACAACAGACGCCACATCCATTGACAGCTTTGGTCCATTGAGTAATGTTAGATTTGCCGTGTTCGCTCTGGGTTCGAGCGCTTACCCGAATTTCTGTAACTTCGGAAAGTATGTAGACAAATTGTTGGTTGACCTCGGCGGGGAACGAATCCACGACCTCGCAACCGGTGACGAAATGTGCGGCCAAGATCAGGCCTTCCGGAAGTGGGCCTCTAGCGTCTTCAACGTTGCTTGTGAGACATTCTGCTTGGATGATGATGAGACTCTACAAGAGGCAAAGAGAGCTCTCGGTACTGTTGCATTAAGCGAGGAGACAGTTCAATTCGCCAGGGCTGGCTGTCGTCCCGCTACGTTACACGCAGCGCTACAAAAGTCTTTGAATAAACAATTCGTTTCTTGCACCGTCAAAGCTAATAAAGATTTAGGCGATGCTTCCGCTGAAAGATCCACCATCTTTATTGATCTGGAACCTAAGGAGGAAATAAAGTATAATCCAGGAGATCATGTCGGAATAATAGCTTGTAACCGTAAAGAGCTCGTTGAGAGTCTGCTCTCCCGCATTAAAGACGTTGATGATTACGACGAGCCGTTGCAGTTGCAGCTTCTGAAAGAAACTCATACGTCAAGCGGTTTAGTCAAATCTTGGGAGCCCCACGAGAAACTTCCGATAATGAGCGTGCGTGAATTGTTCACACGATTCCTTGATATAACAACTCCACCGACCACGATACTTCTTCAGTACTTGGCCACAACGTGCGAAGATGAAGAAGAAAAAAAACAATTGAATGTTTTGGCTACGGATCCCGGAGCTTACGAAGATTGGCGTCATTTCCACTTCCCCACCTTGCCCGAAGTCCTAGATCAGTTTCCATCAGCAAGACCCAATGCATCTTTACTTGCCGCCCTTTTATCCCCACTGCAGCCAAGATTTTACTCAATTTCTTCGTCACCATTAGCCCACGCAAAGAGATTGCATCTTACGGTTGCCGTAGTCACATATCGAACTCAAGATGGTGAGGGACCGGTCCATTATGGTGTGTGTTCCAACTACTTAATGGAACGTAAGCCTGGCGATGAGGTTTACCTCTTTATCAGAAGTGCTCCTAATTTCCATTTACCTCAAGATTTGTCAGTTCCTCTTATACTAATTGGTCCCGGTACTGGTATAGCTCCATTCCGTGGCTTTTGGCATCATCGGCGAGCTCTACAAAATTCTTGCTCGCGTACAACCACTGGACCGGTGTGGCTGTTCTTCGGCTGTCGAACGAAGACTATGGACTTATACCGAGAAGAGAAAGAGCAAGCTTTGAAAGAAGGCGTACTTTCTAAAGTATTTCTCGCTCTATCTAGAGAAAAGGAAGTTCCAAAAACGTACGTCCAAGAAGTTGCTGAAAACGTTGGTGCAGAAATACACGATTTACTAATTAATAAAGGTGCACACTTTTACGTTTGCGGTGATTGTAAAATGGCGGAGGATGTGCACCAGAAGCTCAAAGGTATCGTGAAGAAACACGGAAACATGACAGACGAACAAGTACAGAACTTTATGTTCATGCTAAAGGAAGAGAATCGTTACCACGAAGACATATTCGGCATCACACTGCGCACAGCTGAGGTCCACAGCGCTTCTCGCGAGTCGGCTCGTAGGAACCGCGTCGCTTCCCAACCATGA
Protein
MFEALCNHIKYSTNKGNIRSAITLFPQRTDGKHDYRIWNSQLISYAGYRQPDGTVLGDPMHCEFTDLCLKLGWKPPRTAWDILPLVLSANGKDPDYFEIPRELVMEIHMTHPTFEWFKELELRWYALPAVSSMRFDCGGIEFTANAFNGWYMSTEIGCRNFCDTNRLNVLEKIAQNMGLDTRTPVNLWKDKALVEVNVAVLHSFQQHNATIVDHHTASESFIKHLDNENRLRSGCPADWIWIVPPMSSSITPVFHQEMALYYLKPSYEYQEPAWKTHQWQKSKPITGKRPINRKFHFKQIARAVKFTSKLFGRALSKRIKATVLYATETGKSEQYAKELGVIFGHAFNAQVHCMADYDITSIEHEALLLVVTSTFGNGDPPENGVAFGEHLCEILYADQVGEDSTGNQMLTPKSFIKANSDIQRYTAGNPKKLNRLESLKGSTTDATSIDSFGPLSNVRFAVFALGSSAYPNFCNFGKYVDKLLVDLGGERIHDLATGDEMCGQDQAFRKWASSVFNVACETFCLDDDETLQEAKRALGTVALSEETVQFARAGCRPATLHAALQKSLNKQFVSCTVKANKDLGDASAERSTIFIDLEPKEEIKYNPGDHVGIIACNRKELVESLLSRIKDVDDYDEPLQLQLLKETHTSSGLVKSWEPHEKLPIMSVRELFTRFLDITTPPTTILLQYLATTCEDEEEKKQLNVLATDPGAYEDWRHFHFPTLPEVLDQFPSARPNASLLAALLSPLQPRFYSISSSPLAHAKRLHLTVAVVTYRTQDGEGPVHYGVCSNYLMERKPGDEVYLFIRSAPNFHLPQDLSVPLILIGPGTGIAPFRGFWHHRRALQNSCSRTTTGPVWLFFGCRTKTMDLYREEKEQALKEGVLSKVFLALSREKEVPKTYVQEVAENVGAEIHDLLINKGAHFYVCGDCKMAEDVHQKLKGIVKKHGNMTDEQVQNFMFMLKEENRYHEDIFGITLRTAEVHSASRESARRNRVASQP

Summary

Description
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body.
Produces nitric oxide (NO).
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. Involved in the induction of immune gene expression.
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. Nitric oxide limits plasmodium development in the midgut.
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. Truncated isoforms (isoform 3-isoform 6) are able to form intracellular complexes with the full-length protein and serve as dominant negative inhibitors of the enzyme activity.
Catalytic Activity
H(+) + 2 L-arginine + 3 NADPH + 4 O2 = 4 H2O + 2 L-citrulline + 3 NADP(+) + 2 nitric oxide
Cofactor
heme
FAD
FMN
Similarity
Belongs to the NOS family.
Keywords
Alternative splicing   Calmodulin-binding   Complete proteome   FAD   Flavoprotein   FMN   Heme   Iron   Metal-binding   NADP   Oxidoreductase   Reference proteome   3D-structure  
Feature
chain  Nitric oxide synthase-like protein
splice variant  In isoform 2.
EC Number
1.14.13.39
EMBL
AB360590    AB485776    BAG12563.1    BAH23564.1    MG770226    AYM26646.1    + More
KQ461175    KPJ07899.1    NWSH01000856    PCG73831.1    KZ149998    PZC75366.1    PCG73832.1    ODYU01003891    SOQ43213.1    KQ459302    KPJ01710.1    JTDY01002100    KOB72118.1    AF062749    AAC61262.1    KPJ07898.1    KPJ01712.1    AB071182    AB485775    AB017521    BAB33296.1    BAB85836.1    BAH23563.1    NEVH01006727    PNF36893.1    KQ971372    EFA10400.2    AGBW02008807    OWR52517.1    PCG73834.1    PZC75365.1    KZ288232    PBC31491.1    AB477987    BAH14964.1    MF162295    ATN45429.1    AB204558    BAD89803.1    ODYU01010272    SOQ55265.1    KQ761346    OAD57843.1    KQ414639    KOC66824.1    KJ425527    AJA40862.1    KJ425525    AJA40859.1    KK107770    EZA47847.1    KQ435922    KOX68681.1    KQ434874    KZC09634.1    AB304919    BAF63160.1    GL767121    EFZ14055.1    KQ977141    KYN05369.1    AAAB01008964    EAA12335.2    APCN01000801    APCN01000802    KQ976738    KYM75666.1    AB304920    BAF63161.1    GL438137    EFN69492.1    KQ982691    KYQ52059.1    KQ979038    KYN23479.1    KQ981200    KYN45005.1    GL888378    EGI62001.1    AF130134    AF130124    AF130125    AF130126    AF130127    AF130128    AF130129    AF130130    AF130131    AF130132    AF130133    GL448516    EFN84471.1    ATLV01020382    ATLV01020383    KE525299    KFB45232.1    AXCN02000784    APGK01018684    APGK01018685    APGK01018686    APGK01018687    APGK01018688    APGK01018689    APGK01018690    APGK01018691    KB740082    ENN81585.1    CH477609    EAT38354.1    KY465473    ASG81432.1    UFQS01002944    UFQT01002944    SSX14935.1    SSX34322.1    GBBI01000949    JAC17763.1    DS235133    EEB12398.1    ACPB03007893    U59389    JF502067    AFG22596.1    GAMC01014036    JAB92519.1    GAKP01002324    GAKP01002323    JAC56628.1    GGFL01001306    MBW65484.1    GGFJ01000837    MBW49978.1    AB485762    BAI67609.1    JQ793785    AFJ74715.1    GGFL01001077    MBW65255.1    GGFK01001851    MBW35172.1    GQ429217    ADD63793.1    GGFK01001849    MBW35170.1    GGFK01001946    MBW35267.1    CH933807    EDW12691.1    CP012523    ALC38686.1    GQ865598    ACZ60615.1    CH963852    EDW75640.1    CH916372    EDV98923.1    EU863412    ACJ54486.1    KU306112    ALT10385.1    OUUW01000006    SPP81742.1    JXJN01001049    JXJN01001050    JXJN01001051    JXJN01001052    JXJN01001053    JXJN01001054    JXJN01001055    JXJN01001056    JXJN01001057    JXJN01001058    CH379061    EAL33128.1    CH940649    EDW64760.2    U25117    AF215700    AF215691    AF215692    AF215693    AF215694    AF215695    AF215696    AF215697    AF215698    AF215699    AE014134    BT010016    ABLF02036032    ABLF02036036    ABLF02036037    AY552549    AAT46681.1    CM000157    EDW87996.1    KRT04758.1    CH954177    EDV58972.1    FR875156    CCC18661.1    CH902620    EDV32417.1    CH480818    EDW52506.1   
Pfam
PF00258   Flavodoxin_1        + More
PF02898   NO_synthase
PF00667   FAD_binding_1
PF00175   NAD_binding_1
Interpro
IPR001709   Flavoprot_Pyr_Nucl_cyt_Rdtase        + More
IPR039261   FNR_nucleotide-bd       
IPR003097   CysJ-like_FAD-binding       
IPR036119   NOS_N_sf       
IPR029039   Flavoprotein-like_sf       
IPR012144   NOS_euk       
IPR001094   Flavdoxin-like       
IPR008254   Flavodoxin/NO_synth       
IPR001433   OxRdtase_FAD/NAD-bd       
IPR023173   NADPH_Cyt_P450_Rdtase_alpha       
IPR017927   FAD-bd_FR_type       
IPR004030   NOS_N       
IPR017938   Riboflavin_synthase-like_b-brl       
SUPFAM
SSF52343   SSF52343        + More
SSF63380   SSF63380       
SSF56512   SSF56512       
SSF52218   SSF52218       
Gene 3D
PDB
1TLL     E-value=1.12615e-147,     Score=1345

Ontologies

Topology

Length:
998
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.29119
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  998
 
 

Population Genetic Test Statistics

Pi
213.531004
Theta
170.980429
Tajima's D
0.714031
CLR
0.065279
CSRT
0.574421278936053
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号