SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05877  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002938
Annotation
PREDICTED:_nitric_oxide_synthase_isoform_X1_[Bombyx_mori]
Full name
Nitric oxide synthase       + More
Nitric oxide synthase-like protein      
Nitric oxide synthase, salivary gland      
Alternative Name
Inducible nitric oxide synthase-like protein
dNOS
Location in the cell
Cytoplasmic   Reliability : 2.374
 

Sequence

CDS
ATGGATATACCTGGTCGAGGTGATACCCCGCGGACGGCGGAAGAAGTGTTCAAGGATGCTCAGGCATTCCTCACACAATACTACGCTTCAATCAAGCGAGAGAACTCAGAAGCCCACAAAGCGAGGTTAGACGAAGTGAAGAGGGAATTGAAAGAAAAAGGAACGTATCAACTTAAAACTTCGGAATTGGTGTTCGGGGCCAAGTTGGCTTGGCGTAATGCGACCAGGTGCATCGGAAGAATACAGTGGAAAAAGTTACAGATATTCGATTGCAGAGAAGTGACCACAGCAAGCGGTATGTTCGAAGCATTGTGCAATCACATCAAATACGCTACGAATAAAGGAAATATTCGTTCAGCAATAACGATCTTCCCACAACGCACCGACGGTAAACATGACTACAGAATATGGAATCCGCAGCTTATCAATTATGCAGGATACCAGGAGCCAGATGGAAGCATTATAGGAGATCCAGCACGAGTTGAATTTACAGAGATTTGTATGAAACTTGGATGGAAAGCGCCGCGCACCCCATGGGACATTTTGCCGCTCGTACTCTCTGCTGACGGAAAAGATCCTGAATTCTTTGAACTACCCAAAGAAATAGTTATGGAAGTGCAATTCGAACATCCTGAATATGACTGGTTCAAAGACATGGGTTGGAAATGGTATGCTTTGCCGGCTGTTTCCAACATGAGGCTTGACTGCGGGGGCCTAGAGTTCACAGCTAATTCCTTCAACGGCTGGTACATGGGCACTGAGATCGGATGCAGGAACCTCTGCGATGAGAGTCGACTGAATATTGTTGAGGCTGTAGCCAAGAAAATGGGTCTAGACACAAACTCGTTTGTTTCTCTGTGGAAAGATAAGGCATTAGTTGAAGTTAATATAGCGGTACTGCACAGTTTCCATAGAGATAACGTGTCCATTGTTGATCATCACTCCGCGTCCGAACAGTTCCAGAAGCATTTAGAAAATGAAAATAAAAGCAGGGGCGGATGTCCAGCTGATTGGATATGGATCGTTCCACCGATGTCTTCATCGTTAACCACAGTGTTCCACCAAGAAATGGCCTTGTATTACATCAGACCGTCATATGATTATCAGGAACCACCATGGAAGACTCACCAATGGACAAAGTCTGACGGCACTAAGACCGTCCACAGGAAGTTCCACTTCAAACAGATCGCCAGAGCAGTTAAGTTCACTTCCAAACTGTTCGGACGGGCGCTCTCCAAGCGCATCAAAGCGACTATTCTCTACGCAACAGAGACGGGCAAATCTGAACACTACGCCAAAGAATTAGGAACTATTTTCGGACACGCTTTCAACGCGCAGGTACATTGCATGTCGGAATATGATATGTTTTCTATAGAACATGAGACTTTAGTTCTCATAGTGGCTTCCACGTTCGGCAATGGAGAACCTCCAGCTAACGGAGTCGATTTTGCAGAGCATCTATTTCAAATGCTTTATAATGAGACAAACAATAATCGAGGAGATGGTACAAATGACTTAGGCTCTGGTACGTTCAAGACACCAACACCAAAATCACTGATGAGATCAAACAGTATGATGACACCGAGCTTTGAATATAAGCGGCAATTAACGAGATTAGAGTCTAACAAAAGTAGCGTGGCCGGTGCATCATCTATAGAACAAATAGGACCTCTTAGCAACGTTTGTTTCGCTGTATTTGGTCTGGGGTCGAGTGCGTACCCAAAATTCTGTCATTTCGGTAAAACAGTTGACAAAATCCTTGGTGATTTAGGCGGCGAAAGAATATTAGAACTGGCATGTGGTGATGAATTGTACGGACAAGAACAACAGTTTCGCGCTTGGTCTTCGAAAATATTTCAGGTTGCCTGTGAAACGTTTTGCTTAGATGAAAACGACATGGTAAAAGATGCAAAGAAAGCTTTGGGTGACGTACCGCTGACAGAAGAGACAGTACGTTTCGGAAAATATCAGGGAGATACAAAGCTAAAGGCAGCTCTGGAGGCCAGCTTCAGAAAACAGCTCATTACTTGTAAAGTTAAAGAGAATAAAAACCTAGGGGACTTCTCAGCGGATCGGGCCACAGTATTTGTTGATATGCAACCAGAAACTGAATTCAAATACGATCCAGGAGATCACGTCGGAGTTTTGGCTTGTAATAGAAAAGAAATAGTAGATGCAGTACTAGAGAGGATGAAAGATGTTGACGACTATGATAAAACTGTTCAATTACAAGTGATGAAGGAGACGTTGACACCTACAGGTGCTATAAAGACATGGGAGCAACATGAAAGATTACCAGCGGTAACGATACGACAGATATTTACGAGATTTCTTGACATCACGACACCACCGTCAACGACTGTACTGAAATACTTATCTAAAGCTTGCACTGACCAGAATGATGCTGCCCAACTTAAAGAATTAGCCATAGATTCCAACAAATACGACGACTGGAGGCATCTCCACTATCCACACTTGGCCGAAGTACTAGCGCAGTTCCCTTCATGTCGACCTCAAGCATCTTTGCTAGCGGCCCTACTACCATCGTTACAGCCGAGGTTCTACTCCATATCTTCATCACCACTAGCGCATCCTCATAGAATTCACATCACATGCGCTGTTGTTGTTTACAGGACACAGAACGGACAAGGCCCGATGCATTATGGAGTATGCTCTACATACCTACAAAATCTAAAACCGGAGGACGAAGCCCTAGTTTTCATAAGACGTGCACCAAGCTTCCATATGCCTAAAGATTTATCAGCACCGCTTATTCTTGTCGGCCCCGGCTCTGGTATAGCGCCGTTCAGAGGATTTTGGCATCACAGAAAGCATCAGATCAAGAATTTGATACCGAACAAACAAAAACCAGGTCCTGTCTGGTTGTTCTTCGGTTGCCGAAACAGAGGAATGGATTTGTATAAAGAAGAAAAAGAAAAAGCGTTAGCCGATGGAGTATTGAGCAAAGTTTTCTTGGCACTTTCTAGGGAAGACTCTGTTGAAAAGAAACACATCCAAACGCTACTGGAGGACGAGGGTGCCGAAATCTCACGGATGCTTCTAGACGAAAACGGACATTTCTACGTTTGTGGTGATTGTAAAATGGCTGAAGAAGTTCAACAGAAATTAAAAGAAATCATGAAGAAACATGCCAAAATGACTGAGCAAGAATATGAAGAGTTCATCTTGAACTTGATGGATGAAAACAGATACCACGAAGATATCTTCGGGATCACTCTGAGAACAGCAGAAGTTCAAAGTGCATCAAGAGAATTCGCTAAAAGGACAAGGCAGGAATCACAGAAGTCACAAACTTAA
Protein
MDIPGRGDTPRTAEEVFKDAQAFLTQYYASIKRENSEAHKARLDEVKRELKEKGTYQLKTSELVFGAKLAWRNATRCIGRIQWKKLQIFDCREVTTASGMFEALCNHIKYATNKGNIRSAITIFPQRTDGKHDYRIWNPQLINYAGYQEPDGSIIGDPARVEFTEICMKLGWKAPRTPWDILPLVLSADGKDPEFFELPKEIVMEVQFEHPEYDWFKDMGWKWYALPAVSNMRLDCGGLEFTANSFNGWYMGTEIGCRNLCDESRLNIVEAVAKKMGLDTNSFVSLWKDKALVEVNIAVLHSFHRDNVSIVDHHSASEQFQKHLENENKSRGGCPADWIWIVPPMSSSLTTVFHQEMALYYIRPSYDYQEPPWKTHQWTKSDGTKTVHRKFHFKQIARAVKFTSKLFGRALSKRIKATILYATETGKSEHYAKELGTIFGHAFNAQVHCMSEYDMFSIEHETLVLIVASTFGNGEPPANGVDFAEHLFQMLYNETNNNRGDGTNDLGSGTFKTPTPKSLMRSNSMMTPSFEYKRQLTRLESNKSSVAGASSIEQIGPLSNVCFAVFGLGSSAYPKFCHFGKTVDKILGDLGGERILELACGDELYGQEQQFRAWSSKIFQVACETFCLDENDMVKDAKKALGDVPLTEETVRFGKYQGDTKLKAALEASFRKQLITCKVKENKNLGDFSADRATVFVDMQPETEFKYDPGDHVGVLACNRKEIVDAVLERMKDVDDYDKTVQLQVMKETLTPTGAIKTWEQHERLPAVTIRQIFTRFLDITTPPSTTVLKYLSKACTDQNDAAQLKELAIDSNKYDDWRHLHYPHLAEVLAQFPSCRPQASLLAALLPSLQPRFYSISSSPLAHPHRIHITCAVVVYRTQNGQGPMHYGVCSTYLQNLKPEDEALVFIRRAPSFHMPKDLSAPLILVGPGSGIAPFRGFWHHRKHQIKNLIPNKQKPGPVWLFFGCRNRGMDLYKEEKEKALADGVLSKVFLALSREDSVEKKHIQTLLEDEGAEISRMLLDENGHFYVCGDCKMAEEVQQKLKEIMKKHAKMTEQEYEEFILNLMDENRYHEDIFGITLRTAEVQSASREFAKRTRQESQKSQT

Summary

Description
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. Involved in the induction of immune gene expression.
Produces nitric oxide (NO).
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body.
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. Nitric oxide limits plasmodium development in the midgut.
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. Truncated isoforms (isoform 3-isoform 6) are able to form intracellular complexes with the full-length protein and serve as dominant negative inhibitors of the enzyme activity.
Catalytic Activity
H(+) + 2 L-arginine + 3 NADPH + 4 O2 = 4 H2O + 2 L-citrulline + 3 NADP(+) + 2 nitric oxide
Cofactor
heme
FAD
FMN
Similarity
Belongs to the NOS family.
Keywords
Calmodulin-binding   Complete proteome   FAD   Flavoprotein   FMN   Heme   Iron   Metal-binding   NADP   Oxidoreductase   Reference proteome   Alternative splicing   3D-structure  
Feature
chain  Nitric oxide synthase
splice variant  In isoform 2.
EC Number
1.14.13.39
EMBL
AB071182    AB485775    AB017521    BAB33296.1    BAB85836.1    BAH23563.1    + More
BABH01019194    BABH01019195    AF062749    AAC61262.1    KQ461175    KPJ07898.1    KQ459302    KPJ01712.1    AGBW02008807    OWR52517.1    KZ149998    PZC75365.1    NWSH01000856    PCG73834.1    MF162295    ATN45429.1    ODYU01010272    SOQ55265.1    JF502067    AFG22596.1    MG770226    AYM26646.1    KPJ07899.1    PZC75366.1    PCG73832.1    ODYU01003891    SOQ43213.1    PCG73831.1    AB360590    AB485776    BAG12563.1    BAH23564.1    JTDY01002100    KOB72118.1    AB477987    BAH14964.1    NEVH01006727    PNF36893.1    KQ971372    EFA10400.2    DS235133    EEB12398.1    AB204558    BAD89803.1    KZ288232    PBC31491.1    KQ977141    KYN05369.1    KJ425527    AJA40862.1    GL767121    EFZ14055.1    AB304920    BAF63161.1    KJ425525    AJA40859.1    KQ976738    KYM75666.1    KQ761346    OAD57843.1    KQ981200    KYN45005.1    KQ979038    KYN23479.1    KQ414639    KOC66824.1    KK107770    EZA47847.1    KQ982691    KYQ52059.1    KQ434874    KZC09634.1    GL888378    EGI62001.1    CH477609    EAT38354.1    AAAB01008964    EAA12335.2    GQ429217    ADD63793.1    AB304919    BAF63160.1    JQ793785    AFJ74715.1    AF130134    AF130124    AF130125    AF130126    AF130127    AF130128    AF130129    AF130130    AF130131    AF130132    AF130133    APCN01000801    APCN01000802    ATLV01020382    ATLV01020383    KE525299    KFB45232.1    GL438137    EFN69492.1    KQ435922    KOX68681.1    AB485762    BAI67609.1    EU863412    ACJ54486.1    GL448516    EFN84471.1    GQ865598    ACZ60615.1    GGFJ01000837    MBW49978.1    GGFL01001306    MBW65484.1    KU306112    ALT10385.1    GGFK01001851    MBW35172.1    GGFK01001849    MBW35170.1    GGFK01001946    MBW35267.1    GGFL01001077    MBW65255.1    JXJN01001049    JXJN01001050    JXJN01001051    JXJN01001052    JXJN01001053    JXJN01001054    JXJN01001055    JXJN01001056    JXJN01001057    JXJN01001058    FR875156    CCC18661.1    GAMC01014036    JAB92519.1    AXCN02000784    AY552549    AAT46681.1    CH963852    EDW75640.1    LNIX01000006    OXA52596.1    CH933807    EDW12691.1    OUUW01000006    SPP81742.1    GBBI01000949    JAC17763.1    U59389    GAKP01002324    GAKP01002323    JAC56628.1    CH916372    EDV98923.1    U25117    AF215700    AF215691    AF215692    AF215693    AF215694    AF215695    AF215696    AF215697    AF215698    AF215699    AE014134    BT010016    CH940649    EDW64760.2    CH379061    EAL33128.1    CP012523    ALC38686.1    GQ862349    ACY56317.1    IACF01005756    LAB71339.1    CM000157    EDW87996.1    CH902620    EDV32417.1    CH954177    EDV58972.1    CH480818    EDW52506.1    ACPB03007893    ABLF02036032    ABLF02036036    ABLF02036037    CM002910    KMY89625.1    GGMS01003650    MBY72853.1    SPP81743.1    KU529650    AMV91694.1   
Pfam
PF00175   NAD_binding_1        + More
PF02898   NO_synthase
PF00667   FAD_binding_1
PF00258   Flavodoxin_1
Interpro
IPR017938   Riboflavin_synthase-like_b-brl        + More
IPR004030   NOS_N       
IPR017927   FAD-bd_FR_type       
IPR001433   OxRdtase_FAD/NAD-bd       
IPR023173   NADPH_Cyt_P450_Rdtase_alpha       
IPR008254   Flavodoxin/NO_synth       
IPR001094   Flavdoxin-like       
IPR012144   NOS_euk       
IPR029039   Flavoprotein-like_sf       
IPR036119   NOS_N_sf       
IPR003097   CysJ-like_FAD-binding       
IPR001709   Flavoprot_Pyr_Nucl_cyt_Rdtase       
IPR039261   FNR_nucleotide-bd       
SUPFAM
SSF56512   SSF56512        + More
SSF63380   SSF63380       
SSF52343   SSF52343       
SSF52218   SSF52218       
Gene 3D
PDB
5G0P     E-value=8.15695e-159,     Score=1442

Ontologies

Topology

Length:
1105
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.43567
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1105
 
 

Population Genetic Test Statistics

Pi
241.07294
Theta
189.089799
Tajima's D
0.913215
CLR
0.0233
CSRT
0.633918304084796
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 SFINAIMR 96.00 6e-13
26822097 TSEIVFGAK 100.00 1e-04
28556443 LENFLISNEGTMK 100.00 0.004
26822097 EIVDAVIER 100.00 0.010
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号