SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05874  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002939
Annotation
PREDICTED:_15-hydroxyprostaglandin_dehydrogenase_[NAD(+)]-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.496
 

Sequence

CDS
ATGTCGCACGAATGGAAAGATAAAGTAGTTTTTATAACCGGTGCTGCAACGGGCATCGGTGAATCTGTGGTCAGGATATTATTAGACGAAGGAGTTAAGCATATAGCGATTTTGGACATCGCGGAAGAAGCCGGACAATCGTTACAAGCTGAACTGAATTCGAAATATGGCAACAAAACGAAGTTCTACAGGTCTGACGTCACTGATGAAGAGCACTTCCTGGGAATCCTTAACGCTGTAGTTCAGGAGCAAGGCGGCATTGATGTAGTGATTAATAATGCCGCCCTCATGAACGACAGTATTGGCATTTACAAAAAAGCCATTGAGGTCAACGTGACCGCCTTAATAACAAGTACATTAAAAGCCATTGAGATAATGGGGAAGCACAGCGGTGGTAAAGGAGGTACAGTTATCAACGTTTCTTCGGTTGCCGCTTTGACGCAATCTCACGTTATGCCAATATACTTCGCAACTAAAAGCGCTGTGCTGCAGTTCAGTAATTGTATCGGTAGACCGGAACACTTTTCGAAAACCGGGGTCCGAGTACTGACAGTGTGCTTTGGTGCAACAGACACCGCGTTGTTGACCGACGAGAAACTAGGCACTTTTGATAAGTACTTAGAATCTTCATGCTTGGACCAACTAAAGAAAGGCTTCATATTCCAACGCAAAGAATCCGCAGCTCAAGGCCTCGTTGATTCTTACAAGAAAGGTGAGAGTGGCAGTACATGGCTCGTTGTAAATAACTTGCCGGTTCAAGAGATCAGCGGGTCGGTCGCCGAAGCCTATCAGATTCTTTCTCAGAATGTTTATAGACTTTAA
Protein
MSHEWKDKVVFITGAATGIGESVVRILLDEGVKHIAILDIAEEAGQSLQAELNSKYGNKTKFYRSDVTDEEHFLGILNAVVQEQGGIDVVINNAALMNDSIGIYKKAIEVNVTALITSTLKAIEIMGKHSGGKGGTVINVSSVAALTQSHVMPIYFATKSAVLQFSNCIGRPEHFSKTGVRVLTVCFGATDTALLTDEKLGTFDKYLESSCLDQLKKGFIFQRKESAAQGLVDSYKKGESGSTWLVVNNLPVQEISGSVAEAYQILSQNVYRL

Summary

Similarity
Belongs to the short-chain dehydrogenases/reductases (SDR) family.
EMBL
BABH01019200    BABH01019208    BABH01019201    BABH01019202    MG846919    AXY94771.1    + More
KP899548    AKQ06147.1    AGBW02011082    OWR47240.1    OWR47239.1    KQ459302    KPJ01716.1    KQ461175    KPJ07894.1    OWR47236.1    KF960797    AII21999.1    KP237895    AKD01748.1    GEYN01000012    JAV02117.1    KPJ01719.1    RSAL01000003    RVE54802.1    KPJ07892.1    JTDY01004799    KOB67737.1    BABH01019209    BABH01019210    RVE54801.1    KZ149998    PZC75361.1    JTDY01007982    KOB64820.1    OWR47238.1    KOB67739.1    RVE54803.1    JTDY01007968    KOB64832.1    KQ460366    KPJ15584.1    KC007341    AGQ45606.1    ODYU01002522    SOQ40120.1    SOQ40118.1    KQ459249    KPJ02346.1    NWSH01001071    PCG72771.1    PZC75359.1    NWSH01000014    PCG80831.1    SOQ40119.1    BABH01019219    DQ512730    ABF59817.1    KPJ01717.1    KPJ07893.1    ODYU01010208    SOQ55170.1    KPJ15603.1    KPJ02362.1    ODYU01011579    SOQ57407.1    KPJ02363.1    KP899552    AKQ06151.1    ODYU01006680    SOQ48742.1    PCG72773.1    PCG80830.1    KP237897    AKD01750.1    PCG72772.1    KPJ15583.1    KPJ15602.1    GFTR01004259    JAW12167.1    AY491503    AAR84629.1    KK107119    QOIP01000009    EZA58570.1    RLU18591.1    GEZM01036109    GEZM01036108    JAV82969.1    GBGD01002580    JAC86309.1    LBMM01001364    KMQ96442.1    KPJ15601.1    KK852879    KDR14474.1    KQ979609    KYN20169.1    GBBI01001633    JAC17079.1    GL887491    EGI71071.1    KQ982944    KYQ48859.1    GL437252    EFN70744.1    EZA58571.1    RLU18590.1    BABH01012284    BABH01012285    KQ771134    OAD52541.1    KQ976625    KYM79033.1    KQ982585    KYQ54300.1    JQ398675    AFM38190.1    KQ414755    KOC61724.1    GFTR01004241    JAW12185.1    AAZX01008191    KQ981979    KYN31469.1    JTDY01002703    KOB70885.1    KQ460779    KPJ12399.1    KQ982254    KYQ58773.1    KQ977642    KYN00938.1    JP593077    AER92462.1    GBRD01015928    JAG49898.1    NEVH01014359    PNF27833.1    GBHO01034331    GDHC01017826    JAG09273.1    JAQ00803.1    NNAY01004765    OXU17447.1    KYN31470.1    KMQ96441.1    AGBW02009651    OWR50237.1    GL446000    EFN88615.1    DS235012    EEB10448.1    GL761846    EFZ22664.1    KQ434870    KZC09506.1    ADTU01012731   
Pfam
PF00106   adh_short        + More
PF10545   MADF_DNA_bdg
Interpro
IPR002347   SDR_fam        + More
IPR036291   NAD(P)-bd_dom_sf       
IPR020904   Sc_DH/Rdtase_CS       
IPR006578   MADF-dom       
SUPFAM
SSF51735   SSF51735       
PDB
2GDZ     E-value=4.84231e-26,     Score=291

Ontologies

Topology

Length:
273
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.75598
Exp number, first 60 AAs:
1.49556
Total prob of N-in:
0.15443
outside
1  -  273
 
 

Population Genetic Test Statistics

Pi
182.331363
Theta
170.838367
Tajima's D
0.533114
CLR
0.444464
CSRT
0.518574071296435
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26280517 GGSMHIYGR 96.15 4e-11
26280517 VTVIDYVTPSPQGTK 100.00 3e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号