SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05873  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002940
Annotation
PREDICTED:_15-hydroxyprostaglandin_dehydrogenase_[NAD(+)]-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.455
 

Sequence

CDS
ATGGAGTCGTGGAAAGGAAAAATTGTGCTTATCACTGGTGCCGCAAGCGGTATCGGCGAAGGAGTGGTCCGGCTTATATTGGAGCGAGGTGTCAAGCATGTTGCTATTTTGGATGTTGCCGAGGATTCCGGAAGAGCTCTCGAGAATGAGCTCAATACAAAATACGGTCCCAACTGTGTGAAGTTCTACAAATGTGACGTAACCGTCGAAGAACTTTTTCTGGAATTATTCGATACTGTCAAAAACGAACAAGGCTATCTTGATGTGGTCATCAACAATGCCGCGATCATGAACGACAGCTATAAATCTTACAAAAAACAAATCGATATAAATGTGACTGCTTTAGTTACTGGTACACTGAAAGCTATAGAGATTATGGGAAAGCAGAATGGCGGTAAAGGAGGTACTGTTCTAAATATATCTTCAGTGGCAGCGTTATGTCAATCTCATCTGTTCCCGATTTATTTCGGGACCAAGAGTGCGGTGCTGCAGTTCAGCAACTGTATTGGGTTAGAAGAACATTACGCTAAAAGCGGCGTCCGAGTACTGAGTATTTGCTTTGGCGCGACTGATACTCCACTATTGAACGGAACTAAACTAGGCAGCTTTGATGAAGAAATAGACGGCACTTGTGTTGAGGCCATCCAAAAGAATTATCCTATTCAAAAGATGGAATCTGCAGCCAAAGGTCTGGTCGAGGCCTATGAGCATGCTAAAAGTGGCGACACTTGGATCATCACAACAAACAAACCGGCAAAGAACATCACTGATACATATGAAAAGCGTGGGGGAGAGCACCGAACCTTGTGGAACACCAGCGTTGATGGTCATGGTATCGGAGCAGCAGCCGTCGACGACAACTGCGATGCTCCGTCCATCCAAAAAGCTAGCGATCCACTTGCAGAGTCCCTCAGGGATCCCCCTCTTGCATTGAATACATTAAAAATAATCATGACATATGACTGGAAAGATAAAGTTGTTCTGATTACTGGAGGGGGCAATGGGATCGGATCTCATGTAGTCAGGATTGCACTCGAGGAAGGGGCAAAGGAAATTAATATATTGGACATCAACGAAGCAAACGCGAAATCGCTTCAAGACGAACTGAACGCCAAACACGGAGTTGGAAAAGTGAAATTCATTAAATGCGATGTTGCTAATCACGAAAGCCTAGTGGCAGCCTTCGAAGCTATTTTATCGGACAAAAACAACGAATATGTTGTTCTCAACAACGCTGCTATACTAAATGACAGCTTGAAGACCTACAGAAAACAAATCGATATTAATGTGGCCGCTGTGATCACTGGCTCATTAAAAGCCCTTGATTTGATGAGGAAAAACAAAGGGGGCAAAGGTGGCGCTATAATCAATATGTCTTCAATTGCAGCTCTTTGTCCATTACCTTTTACACCCATTTACAATGCCACTAAGAGTGCCGTGATGCAGTTTAGTGTATGTTTGGGCGCAGACGATTACTACTCGAGGACTGGAGTTCGTGTATTAACTATGTGTTTCGGTGCGACAGATACTAGTCTTATTGCGATTGAGAACATGGGAAGTTTCGATGAAGTTATAGAAACCAAACTCGGTGAACCTTTAAAGTTATATCCCGGACAAAAGATTGAATCCGCCGCTAGGGCAGTTATAGATGCTTATAAACAAGGATCTAGTGGCAGTATTTGGCTGGCCAATGCTAACAAGGCAGCTGAAGACATCACGCACTTTATTGCAATTTTGGACACAGATGTCGAAGCGAGTGAAATGCTTCAGGATAAAATGATGACTGAATATGTTAATTCTAAAGTAAAATTCATAGAGTGTGACGTCACTGTCAATGAAGAACTTTTTGGGATTGTCAAAGAAATCGGATATATTGATCTAGTTATTAATAATGCTGGGATAGCCAATGAATCAGATCCAAAAGCAATAAGAAAAGAAGTTGAGGTTAATTACAGGGAAGAATATTACAGTAAAACAGGAGTGCGCATTCTAACTGTGTGCTTTGGAATCACGAAAACTGGCATTTACAACAACCTGAGAAGTTTTGATGAAAACATTAACAAAGATATGCAACAGATTATAGATTTATATCCCATGCAGTCAAAAGAGTCAGCAGTCAAAGGTGGGATAGAAGCAATCAAGAAAGGTGAAAGGGGTAGCACCTGGCTCGTAGCTAAAGATAACCCAGTGGTCGATGTCACATCAAATCATGTTGCTGTTTTGGATGTTGCCGAGGATTGCGGAAGAGCTCTTGAGAATGAGCTCAATACAAAATACGGTCCCAACAGTGTGAAGTTCTACAAATGTGACGTAACTGACGAAGAACTTTTTCTGGAATTATTCGATACTGTCAAAAACGAACAAGGCTATCTTGATGTGGTCATCAACAATGCCGCGATCATGAACGACAGCTATAAATCTTACAAAAAACAAATCGATATAAATGTGACTGCTTTAGTTACTGGTACACTGAAAGCTATAGAGATTATGGGAAAGCAGAATGGCGGTAAAGGAGGTACTGTTCTAAATATATCTTCAGTGGCGGCGTTATGTCAATCTCATCTGTTCCCGATTTATTTCGGGACCAAGAGTGCGGTGCTGCAGTTCAGCAACTGTATTGGGTTAGAAGAACATTACGCTAAAAGCGGCGTCAGAGTACTGAGTATTTGCTTTGGCGCGACTGATACTCCACTATTGAGCGGAACTAAACTAGGCAGCTTTGATGAAGAAATAGACGACACTTGTGCCGATTTCATCAAAAAGAAATATCTATTGCAAAAGATGGAATCTGCAGCCAAAGGTCTGGTCGAGGCCTATGAGCACGCTAAAAGTGGCGAAACTTGGATCATCACAAAAAACAAACCGGCGAAGAACATCACTGATACAATGGAGTGGACGCTTAAAGAAGACCGTGTTGCAGTTATTGCGTTGCATCGTTGCGGTTACGCGCCAATTCAAAATTTTAACATACTGAAAAATTTGAATATAACCAAAAGATTCGTTTATCGTACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAGGTCAAGAAGTGGTCGCTCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCGAATTCAAAGAAATCCCAAACAAGAGAGCTACAACAAACAAAATGATAAGGTGTATGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCATGTCCAGCGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTATGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGTGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCGCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATTACGGAGGTCGTTTTGAATAA
Protein
MESWKGKIVLITGAASGIGEGVVRLILERGVKHVAILDVAEDSGRALENELNTKYGPNCVKFYKCDVTVEELFLELFDTVKNEQGYLDVVINNAAIMNDSYKSYKKQIDINVTALVTGTLKAIEIMGKQNGGKGGTVLNISSVAALCQSHLFPIYFGTKSAVLQFSNCIGLEEHYAKSGVRVLSICFGATDTPLLNGTKLGSFDEEIDGTCVEAIQKNYPIQKMESAAKGLVEAYEHAKSGDTWIITTNKPAKNITDTYEKRGGEHRTLWNTSVDGHGIGAAAVDDNCDAPSIQKASDPLAESLRDPPLALNTLKIIMTYDWKDKVVLITGGGNGIGSHVVRIALEEGAKEINILDINEANAKSLQDELNAKHGVGKVKFIKCDVANHESLVAAFEAILSDKNNEYVVLNNAAILNDSLKTYRKQIDINVAAVITGSLKALDLMRKNKGGKGGAIINMSSIAALCPLPFTPIYNATKSAVMQFSVCLGADDYYSRTGVRVLTMCFGATDTSLIAIENMGSFDEVIETKLGEPLKLYPGQKIESAARAVIDAYKQGSSGSIWLANANKAAEDITHFIAILDTDVEASEMLQDKMMTEYVNSKVKFIECDVTVNEELFGIVKEIGYIDLVINNAGIANESDPKAIRKEVEVNYREEYYSKTGVRILTVCFGITKTGIYNNLRSFDENINKDMQQIIDLYPMQSKESAVKGGIEAIKKGERGSTWLVAKDNPVVDVTSNHVAVLDVAEDCGRALENELNTKYGPNSVKFYKCDVTDEELFLELFDTVKNEQGYLDVVINNAAIMNDSYKSYKKQIDINVTALVTGTLKAIEIMGKQNGGKGGTVLNISSVAALCQSHLFPIYFGTKSAVLQFSNCIGLEEHYAKSGVRVLSICFGATDTPLLSGTKLGSFDEEIDDTCADFIKKKYLLQKMESAAKGLVEAYEHAKSGETWIITKNKPAKNITDTMEWTLKEDRVAVIALHRCGYAPIQNFNILKNLNITKRFVYRTIKRYNEDSSVDDRSRSGRSRSVRTPAVIKAVKARIQRNPKQESYNKQNDKVYAHSSEEASNRIPHVQRGHFPSSLMVWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTNLMEPVSHTMFNNRHWVFQQDSVPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHRNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNYGGRFE

Summary

Uniprot
ProteinModelPortal
PDB
2GDZ     E-value=2.14948e-28,     Score=318

Ontologies

Topology

Length:
1233
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.840099999999999
Exp number, first 60 AAs:
0.37748
Total prob of N-in:
0.02960
outside
1  -  1233
 
 

Population Genetic Test Statistics

Pi
282.418286
Theta
192.361561
Tajima's D
0.9985
CLR
0.797986
CSRT
0.655067246637668
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 IVLITGAASGIGEGVVR 100.00 4e-04
28556443 IVLITGAASGIGEGVVR 100.00 4e-04
28556443 HVAILDVAEDSGR 100.00 4e-04
28556443 IVLITGAASGIGEGVVR 100.00 4e-04
28556443 HVAILDVAEDSGR 100.00 4e-04
28556443 HVAILDVAEDSGR 100.00 4e-04
26280517 SFFEVAGQAR 100.00 0.006
28556443 ALENELNTK 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号