SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05866
Annotation
PREDICTED:_uncharacterized_protein_LOC106713162_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.034
 

Sequence

CDS
ATGGATATCGTGAAGTGTAATAACTGTAACATAGTTATTTGTGAGCTATTGGCTTTTGTGCAAAATAAAGCTGATGTAATGGATGAAGACAGTATACTTCGTCTGTGTTCTACTGCGTTCACGACTGATGAAATCACACAGGCGAAAAAATTACTTTTCGAGTCTGTACAAACTACAACTCGAAGGGTACATAGAAAAGGTGAAGGAAAAAGTAAGCGAGATATGGAAGATATTCTATGTGTGATCAAAGAAACAGACCCTGATTTGGTACCTATTTTTGTGGCAAGGGACTTACATCGTCTTCCCCCGGTCACATTTGACCATATAGATGCCACGAGATTGTTAAGGGACATTATTAAACTGCAAGATAATGTGTTGTTTATAAAAGAAAACTATGCTACAAAAGAAATGGTTTTAAATCAAACTTCGGAGATATATGGAAACAAAAAGAGAGGGGCTGCTATTTTAGAAGACAGTTTTGATTGCAATGGTAGTCCAGTTGGTCTTCCGCATATTTCAACGGAAGAATTTCAAACCGATTCAACGGATATCATTCATACTTCTTGCATTGACAACACAAAGACTCAACGCCCGGTGGCTCACTTACTGTCATCTGATTCGCTCGCACGCAAGGAACAAATAAAAATGAATATTCTTGCCACAAAACACGAACAAAAAGACTTCCGAGGTTTCTGGAAACAAACAAGGAGATTGAGTCCAAAAGCTGGTATCCCGGTGAGCATTGATGGCGAGTGTGAGCCTGTGAGGATTGCTAATCTGTTTAGGAACCATTTCAGGGTACAATCACCCGGTCAGTTAAGTAGAGGTGCTGATGCTGGGGTGGTGGACCCGAGTCGACCCTCGCAAGTACCACCTCGGATAACAACGAAGGAAATAACTAAAATTATAATGAATATGACTAAGGGTAAGTCTCCCGGTCATGACCACCTCAGCATTGAGCACTTTCAACACGCCGGTCCGCATTTACCTAGATTGCTAGCGCTCTTATATACCTTCTGTATCAGACATTCGTATCTGCCCGGGGCGTTAATGAGAACGGTCGTTGTCCCGATTTTAAAAAATAAAACAGGCGACGTATCGGATCGTAACAACTATCGGCCGATCTCCCTGGCAACCATAACTGCTAAGGTACTCGATGCAGTGCTCGAGCGGCAGGTGAGTGATCATCTTACATTAAGTGATGCTCAGTTCGGTTTTAGACCGATGCTATCTACCGAGTGTGCAATCCTGTCGCTAAAGCATGTGGTGGGATACTACACGGAGAGGAATACGCCTGTTTATGCAGTGTTTCTCGATCTTTCGAAGGCTTTCGACCTAGTCAGGTACGACTTGTTGTGGGGTAAGTTGAGGCAGACGGGCGTACCGGGACCTTACGTGGACTTGTTCTCCCATTGGTACGAGTATCAGACCAATCAGGTAAGATGGTCAAACACACTTTCGGAGGAGTACAGGTTGGAATGCGGGGTGAGGCAGGGGGGCTTAACCTCACCGGCGCTTTTCAACCTGTATATTAATGAGTTGATCGAGGCACTCGGTGAGGCACGTGTCGGCTGCTCGATCGATGGTCACTGTGTGAACAGCATCAGTTACGCTGACGACATGGTGCTGTTGAGCCCATCGATCGGTGCTCTCCGGCGGTTGTTGTCCATCTGTGAGAGGTACGCGGAATTTCACGGGCTCCGCTATAATGTTAAAAAAAGTGAACTGCTCGTCTTTAAGGCAGCAAAGACAAAACCGAGTTATGTGCCACCAGTGACGCTCGGAGGTACTCCACTGAAGAGGGTTACTGAGTTCAAATACCTTGGCCATATTGTAACTGAGCACCTTAAAGATGATGCAGATATTGAAAGGGAACGGAGAGCGTTGGCTGTCCGCTGCAGTATGCTGGCCCGCAGGTTCTACCGTTGTACCGCACAGGTTAAGGATGTTGTTGGGGCTCCCGCGGTACTGTAG
Protein
MDIVKCNNCNIVICELLAFVQNKADVMDEDSILRLCSTAFTTDEITQAKKLLFESVQTTTRRVHRKGEGKSKRDMEDILCVIKETDPDLVPIFVARDLHRLPPVTFDHIDATRLLRDIIKLQDNVLFIKENYATKEMVLNQTSEIYGNKKRGAAILEDSFDCNGSPVGLPHISTEEFQTDSTDIIHTSCIDNTKTQRPVAHLLSSDSLARKEQIKMNILATKHEQKDFRGFWKQTRRLSPKAGIPVSIDGECEPVRIANLFRNHFRVQSPGQLSRGADAGVVDPSRPSQVPPRITTKEITKIIMNMTKGKSPGHDHLSIEHFQHAGPHLPRLLALLYTFCIRHSYLPGALMRTVVVPILKNKTGDVSDRNNYRPISLATITAKVLDAVLERQVSDHLTLSDAQFGFRPMLSTECAILSLKHVVGYYTERNTPVYAVFLDLSKAFDLVRYDLLWGKLRQTGVPGPYVDLFSHWYEYQTNQVRWSNTLSEEYRLECGVRQGGLTSPALFNLYINELIEALGEARVGCSIDGHCVNSISYADDMVLLSPSIGALRRLLSICERYAEFHGLRYNVKKSELLVFKAAKTKPSYVPPVTLGGTPLKRVTEFKYLGHIVTEHLKDDADIERERRALAVRCSMLARRFYRCTAQVKDVVGAPAVL

Summary

Pfam
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=1.71554e-07,     Score=135

Ontologies

Topology

Length:
657
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02575
Exp number, first 60 AAs:
0.00548999999999999
Total prob of N-in:
0.00291
outside
1  -  657
 
 

Population Genetic Test Statistics

Pi
374.340412
Theta
217.796641
Tajima's D
2.263148
CLR
0.424417
CSRT
0.92090395480226
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号