SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05825
Annotation
PREDICTED:_uncharacterized_protein_LOC106136784_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.767 Nuclear   Reliability : 2.021
 

Sequence

CDS
ATGCCGATCACCAGGAGCAACAAGGGATCATCGAGGGAACAGCCACTCGAACCTGCGGTTCAAGAATCCAGTCCGGAGGCAACAGAAGCGACGTCGTACGAAACATACGAGAGCTCCGCGACCGGTACGACCCAGAACACAAAACTTGAAGAGGCAACGACGCGGACACGTGGTGAAAATAGACCCGCGTCGAAGAAATCGCTACGACGTAAGGAACTGGCAGCGAGAGCGGAGCTGGCGGAAAAAGAATTGATAGAAGCACAAGCAGCCACTATAGCCGCCAGACTCCGCCTGCAATTGATTCAGGCCGAAAGCGAAGACGACGATGATTCCATTATAGAAGAGCCAAAGGACCGGGAGGACCAGGTCAGGGCCTGGGTCCAGACGTCGGCGGGCAGTATGGACAAGGAGCCCGCAGGCGAGCACATTGAGAACCACCCCGTCAGCAAGGCCAACATGGAAGATTGCAGCAACAGGGACCTGGCTAAGGCGATAGTGGAAGCAGTGAGGAGCGCAACGACCAAGGAGCTGCCGCCACAACCCGACTACATGCACCAGTTGCCGACGTTCGAAGGCGACTGCAGGGAGTGGGTGGCCTTCAAGGCTGTCTACGAGGATACCGCTCCACTCTTCTCAAAACATGGCGCGGCTGAGAAGAGCGCTGAAAGGACAAGCCAGGGAAGGAGTCCGCAGCCAGCTGTACTCCGAGAGCACACCGGAGGAACGATCAGGGGGCTGCGGAAACCCCAATATTTGATGTCGCCCGAACTGCTGAAGAGCATCGTCGACAAGATGCCGACCATCCTGAGGTTCCGGTGGTACGATCACATTATCGAAAAGACCGAAGGAGACCCGGACCTCAACACGATGTGCGGCTTCCTGAACAAGATGGCGGACCGGTGCGGGCCACACGCCGTGGCTGAAGTAGCAACGAAAAGACAACCATCGAGGCGACAGGCGACGCACGCCACAACCGACTGCACCGAGCGCGCAACTTCGGACAGAGTAATAATAGACAAGCCGGCGTGCCCGCAATGCAAGGATGGACACCCGCTGTACGATTGTCCGAGGTACAAGGGCGCTACAGTGCAGGAACGATGGAGAATGGCAAAGGAGTCGCGCCTATGTTACAAGTGCCTCGATGGTGAGCACCGAAAGCAATCGTGTCAACGACCGCCATGCCGCACGTGCAAGCGCTGGCATCACCACTCGCTACACAACGAGAAGCCGGAGACAGAGCCAGCAGAGAACAGGGAAATCGCGAACAACGTGCGACTTCCCATCAACTGCACACAGATCAGCAGGGCGTACTTGAAGATGGTGCCCGTTGAAGTGTACGGGCCATCGGGATCGACGACGGTGCTGGCCCTGCTGGACGAAGGCTCCACTGTAACTCTCCTGGACTCGAGCGTGGCGAAGCAGATCGGCCTGAAGGGACCCAAAGAGATGCTCCGCCTCGAGACCGTGGGCGGGAAGACCCTAGCGAAGAAGGACTCGATGAAGCTTAACATCCGAGTTCGAGGGCTTCACCAGCGGCAGAAGAGGACGATCTTCGGAGCGCGCACAATGGACGACATGACCCTTGCACCCCAGCGATTGAAAAGAGAGACCATCGAAGGCTACGCGCACCTGAGGAGCCTAGCGGACCAGTTAAATTACGAAGAACAATCCCCCAAACTATTGATTGGGCAGGACAACTGGGGACTCATCGCCGCCAAGACGACGCGCAGGGGCAAGAGGAACCAGCCGGTAGCCTCATTCACCCAATTGGGATGGGTGCTACATGGTCTCGACGGCAACAACGCAAAAGAGGTCAACTTCCTCACCTGCGCCCATGTATCGATGCGCGAAGAGGCCTTGGACAGACTGGTGAAGGAGCACATCGCAATAGAGTCGCACCCAAGCGTCCGAGCACGGATATGGAGGCGAAGGCTCGTCGCGGTTGTCGCGGACATCAAGGAGAGGTTCCTGCAGATAAGGATCAGGGACGAGGACCGCGACAGCCTGAGATTCCTCTATAGAGAAGATCGACGCGAGGCCGCTTCAAAAGAGTATAGAATGACGTCGGTCATATTCGGAGCGGCCTTTTCAACGAGCGCGGCGCTGTTCGTTACAAATAAGAATGCCAAGGATTACAGATATCAATATCCAGAAGCCGCGCGGGCAATAGAAAGAAACCACTACATGGACGACTACCTGCAGAGCTTCGAGACGGAAGAAGAGGCTATAACCATAGCCAGCGAAGTGGATGTCGTCCACCGTGGAGCGAAATTCGAGCTCAGAGGCTGGGCATCGAATAGGCGCGGCGTCTTGGCGAGCCTCGCAGGTGGTGCGACCCCAGGAGACATAGAGCTGGGGTCGAAGGAAGAAAAGACCCTGGGCCTGCGGTGGTTCTACGAGTCGGACGAGATGGGATTCCAGACACATCCACGAGACCCAAAGGATATAGAAGCACGAACCCCGACCAAACGAGAAGAGCATTTGGCGGAGCGGGATCGACTGGGACGACGTCATCCTGGAAAAGGACGAGGTGGCGTGGAAACCTTCGCATGCTGCAAGGCCTCCGAATGGCAAGTCTATTGGCGTCAGAAGGCAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCCATCCCAAGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGGGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCAAGTTCCTGACGTGGGATGGATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAAAGAAAGAGGTCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGACCCACGCCCGATCCGCACAGATTCTCAAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCTCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGGAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGAAGTTAAGGACCCCGGAAGCACCTAAAGAAGCGTGGCTGCTGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTAATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGGTGCGGCAGCGCTACTGGATCCTAGGTCTAAGATCGATCATTCGAGCGACGGCCGTCCGATGCCAGTGGTGCAAGGTCTATCGGAGTACACCACGACTACCGCCCACCGGAGACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCGATGACGGTGACTGTAGGACGACGTCACGAGAAGAGGTGGGGCGTGCTGTTCACATGCCTCACCACGAGAGCAGTCCACATGGAGCTAGCAGCGTCACTGACGGCAGACTCAATGCTGTTAGCGCTGCGCAGGATGGCCGCCCGGCGAGGAACGCCCAAAGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCCAACAAGGAGCTTAAGCAGGCAATCGAGAATGCAAGGGAAGCAGACGTCGTGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGCGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTCTGCACACTCTTCTGTTGGAGGCGGAGCACGTCGTCAACTCGCGACCGCTCGTCGCCAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAATCACTTCCTCATAGGGAGGTCCTGCGGAGCTCCAAGCATCGGCGACTACAGAGACGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCGGACCACTTCTGGAGTAGGTGGGTCAAGGAATACCTGCCTACGCTGCTGCCCAGGAAGATCGACGGGAGAGCAGCTGGCGAGGACTTGCAGTGTGGGGATACCGTCCTCATAGTGGACTCCACGCTGCCACGCAACACATGGCCGCGCGGGCAAGTTGTCCACACCTACCCAGGCCCCGACAACCGTGTACGAACCGTCGACGTCAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACTACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCACAATTATAG
Protein
MPITRSNKGSSREQPLEPAVQESSPEATEATSYETYESSATGTTQNTKLEEATTRTRGENRPASKKSLRRKELAARAELAEKELIEAQAATIAARLRLQLIQAESEDDDDSIIEEPKDREDQVRAWVQTSAGSMDKEPAGEHIENHPVSKANMEDCSNRDLAKAIVEAVRSATTKELPPQPDYMHQLPTFEGDCREWVAFKAVYEDTAPLFSKHGAAEKSAERTSQGRSPQPAVLREHTGGTIRGLRKPQYLMSPELLKSIVDKMPTILRFRWYDHIIEKTEGDPDLNTMCGFLNKMADRCGPHAVAEVATKRQPSRRQATHATTDCTERATSDRVIIDKPACPQCKDGHPLYDCPRYKGATVQERWRMAKESRLCYKCLDGEHRKQSCQRPPCRTCKRWHHHSLHNEKPETEPAENREIANNVRLPINCTQISRAYLKMVPVEVYGPSGSTTVLALLDEGSTVTLLDSSVAKQIGLKGPKEMLRLETVGGKTLAKKDSMKLNIRVRGLHQRQKRTIFGARTMDDMTLAPQRLKRETIEGYAHLRSLADQLNYEEQSPKLLIGQDNWGLIAAKTTRRGKRNQPVASFTQLGWVLHGLDGNNAKEVNFLTCAHVSMREEALDRLVKEHIAIESHPSVRARIWRRRLVAVVADIKERFLQIRIRDEDRDSLRFLYREDRREAASKEYRMTSVIFGAAFSTSAALFVTNKNAKDYRYQYPEAARAIERNHYMDDYLQSFETEEEAITIASEVDVVHRGAKFELRGWASNRRGVLASLAGGATPGDIELGSKEEKTLGLRWFYESDEMGFQTHPRDPKDIEARTPTKREEHLAERDRLGRRHPGKGRGGVETFACCKASEWQVYWRQKADESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPKFLTWDGSRWPKPRTFKQEPSGEKKEVFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLEQQDPTWRTTRTKQPRSTWKLRTPEAPKEAWLLLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNEVRQRYWILGLRSIIRATAVRCQWCKVYRSTPRLPPTGDLPIERLRHGEPPFTCAAVDYFGPMTVTVGRRHEKRWGVLFTCLTTRAVHMELAASLTADSMLLALRRMAARRGTPKVIYSDNGTNFVGANKELKQAIENAREADVVSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALAVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNHFLIGRSCGAPSIGDYRDEDLTGKRTWRVAQRMADHFWSRWVKEYLPTLLPRKIDGRAAGEDLQCGDTVLIVDSTLPRNTWPRGQVVHTYPGPDNRVRTVDVRTSGGLLKRPASKMILLVPATSDEPTPIESPLQGVGATHEGEDVGDSGVAPQL

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1577
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01742
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00022
outside
1  -  1577
 
 

Population Genetic Test Statistics

Pi
365.558536
Theta
200.237701
Tajima's D
2.886193
CLR
1.025734
CSRT
0.973801309934503
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号