SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05822
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 3.189
 

Sequence

CDS
ATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAATGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAATATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGACCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTAAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTACAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAAAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTCAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATACTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATACCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCAGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTAGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCTCCGCCCCCGCCGTTCGCCCAATCACGATATTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATTAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTCCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAATGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGTTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAACTAA
Protein
MVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSNDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCDPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERKASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGSPPNTTLSIPLPTRRVNTSAPAVRPITIFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAVNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    GGMR01018716    MBY31335.1    GFTR01008038    JAW08388.1    S59870    AAB26437.2    GGMS01006359    MBY75562.1    GGMS01002992    MBY72195.1    RPOV01000134    RPJ78669.1    NEVH01006736    PNF36716.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    ABLF02024246    GGFJ01001843    MBW50984.1    GGMR01003407    MBY16026.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02008153    ABLF02008462    ABLF02008464    KK119692    KFM76444.1    GFTR01008279    JAW08147.1    GEZM01053022    JAV74219.1    GGFJ01002256    MBW51397.1    GFTR01008262    JAW08164.1    GGFJ01002257    MBW51398.1    KQ973412    EFA12510.2    ABLF02029306    ABLF02029314    ABLF02060138    NEVH01011985    PNF31054.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGFJ01001858    MBW50999.1    NEVH01020940    PNF20481.1    NEVH01021205    PNF19912.1    ABLF02034467    GGFJ01001857    MBW50998.1    GFTR01008271    JAW08155.1    GEDC01000337    JAS36961.1    GFTR01008261    JAW08165.1    GGMR01000676    MBY13295.1    NEVH01026386    PNF14434.1    NEVH01016302    PNF25823.1    GBGD01000415    JAC88474.1    GFXV01000908    MBW12713.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    KQ973363    EFA13335.2    GGMS01017365    MBY86568.1    NEVH01022639    PNF18527.1    GGMR01012305    MBY24924.1    NEVH01017470    PNF24199.1    ABLF02023911    DNOY01000259    HBE18313.1    GFTR01008269    JAW08157.1    JRES01000644    KNC29657.1    KK119261    KFM75202.1    GFTR01008257    JAW08169.1    GEZM01084969    JAV60363.1    LBMM01013518    KMQ85605.1    GGMR01013409    MBY26028.1    GGMR01006408    MBY19027.1    GGMR01016905    MBY29524.1    NWSH01007753    PCG62823.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMR01016296    MBY28915.1    GFTR01008251    JAW08175.1    ABLF02028535    ABLF02028545    NEVH01023280    PNF18085.1    GGMR01000226    MBY12845.1    GBGD01000389    JAC88500.1    GGMR01003864    MBY16483.1    AF237761    AAF81411.1    GFTR01008256    JAW08170.1    GFXV01002840    MBW14645.1    AY060438    AAL25477.1    GGMS01000737    MBY69940.1    NEVH01005277    PNF39135.1    GBBI01003810    JAC14902.1    ABLF02041767    GFTR01008151    JAW08275.1    M38437    GBHO01008295    JAG35309.1    GEHC01000968    JAV46677.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00207433,     Score=101

Ontologies

Topology

Length:
902
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.60566
Exp number, first 60 AAs:
0.02203
Total prob of N-in:
0.00801
outside
1  -  902
 
 

Population Genetic Test Statistics

Pi
142.646942
Theta
18.360344
Tajima's D
1.354416
CLR
0.728187
CSRT
0.755362231888406
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号