SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05819
Pre Gene Modal
BGIBMGA006947
Annotation
PREDICTED:_uncharacterized_protein_LOC105842971_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.429
 

Sequence

CDS
ATGCCTCGAAATTATAAACCGAATCCACGTGGTAAGCAGTATCGCAAATACGATGATGCTACAATTAAGCAAGCTTTGGAAGTATACAATACCACTCCAAATTGTTCAATATCTGTCATTGCAAAACAGTACAACATTAATAAATCAGTTTTATATCGGCATAATAGAAAAACAATGAAAAAGCAAGGTGGGCAAACTGCTTTAGACGATGACACAGAACATCACATTGTACAGTATTTAAATGTTTGTAGTGATTGGGGCTATCCATTAGACACATATGATTTAAGAATAATGGTGAAATTGTATTTGGATAATATGGGTATCACTCATAACCGTTTCAAAGATAATATGCCAGGGCCAGATTATGCCACAAGATTTTTAAAAAGGCACAAAGATTCCATTTCTTTGAGATTATGTCAAAATATTAAAAAATCAAGGGCTCGAGTATCGCCCGATACTATCGAAGAATATTTTGGAGAGTTGGAAGAGACATTAAAAGAAATCGACCCAAACAATATCGTCAATTACGATGAAACAAATCTCAGTGATGATCCTGGGCGAAAAAAGGTAATTGTTAAAAGGGGAACCAAGTACCCTGAAAGGGTACTTAATCAATCAAAATCATCCATATCAATTATGATGGCTGGTACAGCAGCAGGAGTGCTTTTACCTCCTTATGTAATTTATAAAGCTAGTAATGTTTATGACTCCTGGACCACAGGTGGACCCAAAGGAACGCGGTATCATAGAACTGCATCTGGATGGATTGATGGTAACACGTTCGAAGATTATATTAAATGCATTATAATACCATTCTTTAAAGATAAACCAGGAAGAAAAATACTGATTGGGGATAATTTATCATCCCATTTGTCTATAGAGGTAATTAAAATTTGTGAAGAGAATCATATTTCATTTGTTTTTTTACCGGCCAATTCGACACATTTGACACAACCTCTGGATATCGCCTTCTTTAGACCGATGAAAATGGCATGGAGAAACATTTTATTACGATGGAAAAAAACAGATGGCAGATCCCAAGCTACAGTACCAAAAGGTTGCTTCCCAAGGTTGTTAAAACTACTTATAAACGAATTGTCAGAAAACGTCGATTCGAACCTTAAAGCAGGTTTTCGAAAAGCAGGGATTATTCCTATTGACCGCAACGAAGTTCTTTCAAGGCTTCCCAAAGAAAACACTGAAGACCCTGAAAAATCGAGATATGCAGTTGACAAGTCCGTTTTAGATATATTAAAAGAAATGCGGTATGGTACCATAAATATCAAAGAACCAGCACATAAAAGTAAAATTAATGTAGATTCTGGCAAGAGCTTGGGAAACATAGATGAGGAAAACTTTGAAACTGAGTCTGAAAACGAAACTACTAGTAAGCGACCAAAGACACGTAAACAAGGCAACAAGAAGAAAAAGATCAAAGTAATTCCAGGAAAAGCAGTCGATTTAAATTCTGAAGATAATAAAACTGAAAATGAAGAACGTAATATAGCTAACACTGAAAATGTAATAAAAAAATATAAGAAGAAAGTGGTGCGGGCACCCAAATGCAAGATAAATAGTAAGAAAAAAGAAGTAAAAACTCTAATAGACAAGTTAAAAACGGATTTGATGAAGAAAGAGATGGAAACGAATACGGGGACACCAAAATATAACGAAACAAAAAAAATAGATGTAAGTGTATTACCAATGGTATGTGTTGATGAATGTATTATTGCCAGTTGCTCAGAAAATACTAATAATACTTGCAATGATTTAAATCACAAAAAGAACTATGAAGAAGTAATTGACAATAACTGCAATAGTTACAAAGAATCATTTCATCAAGAAAATAATTTTGAAGATTATTGGGGCAATGGTTCGCAACAAAAAGATGATGAACTGTTTGTTAACACCTACTTTGATAAAGATGTAGCAAACGAAGATTATGTTCCAGACATAGTAACAGAAAACATATTTCACGAATTAATAGACCCCCTAAAAGATGGGGTATGTGTAAATTATAACAGCTATGCAGCAGAAGCAACAGCAGAAAACAATAATTCCAAAGATAAAAAAATCGCTATTATTTCTGTAGAAAATGTTGATAGTGATAGTCGTCCGGTAACTCTAAATAAGTGTAAAAAAATATCTTTAAATTCCATAGTTAGCGTTAAAAAAGATAACAGCCAGAACTCCAAAAACATAAAACAAGTTAAAAGTAAATTACGCAGAAGAAGCTATTACAAAAATGAGGCTGATATTTTAAGAGATTTGATTGATGACAATATTCAATAA
Protein
MPRNYKPNPRGKQYRKYDDATIKQALEVYNTTPNCSISVIAKQYNINKSVLYRHNRKTMKKQGGQTALDDDTEHHIVQYLNVCSDWGYPLDTYDLRIMVKLYLDNMGITHNRFKDNMPGPDYATRFLKRHKDSISLRLCQNIKKSRARVSPDTIEEYFGELEETLKEIDPNNIVNYDETNLSDDPGRKKVIVKRGTKYPERVLNQSKSSISIMMAGTAAGVLLPPYVIYKASNVYDSWTTGGPKGTRYHRTASGWIDGNTFEDYIKCIIIPFFKDKPGRKILIGDNLSSHLSIEVIKICEENHISFVFLPANSTHLTQPLDIAFFRPMKMAWRNILLRWKKTDGRSQATVPKGCFPRLLKLLINELSENVDSNLKAGFRKAGIIPIDRNEVLSRLPKENTEDPEKSRYAVDKSVLDILKEMRYGTINIKEPAHKSKINVDSGKSLGNIDEENFETESENETTSKRPKTRKQGNKKKKIKVIPGKAVDLNSEDNKTENEERNIANTENVIKKYKKKVVRAPKCKINSKKKEVKTLIDKLKTDLMKKEMETNTGTPKYNETKKIDVSVLPMVCVDECIIASCSENTNNTCNDLNHKKNYEEVIDNNCNSYKESFHQENNFEDYWGNGSQQKDDELFVNTYFDKDVANEDYVPDIVTENIFHELIDPLKDGVCVNYNSYAAEATAENNNSKDKKIAIISVENVDSDSRPVTLNKCKKISLNSIVSVKKDNSQNSKNIKQVKSKLRRRSYYKNEADILRDLIDDNIQ

Summary

Uniprot
Pfam
PF03184   DDE_1
Interpro
IPR004875   DDE_SF_endonuclease_dom       
ProteinModelPortal

Ontologies

Topology

Length:
763
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.973
Exp number, first 60 AAs:
0.00244
Total prob of N-in:
0.04606
outside
1  -  763
 
 

Population Genetic Test Statistics

Pi
187.987158
Theta
163.464504
Tajima's D
0.246923
CLR
0.024226
CSRT
0.441077946102695
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号