SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05814
Annotation
PREDICTED:_uncharacterized_protein_LOC105386002_isoform_X1_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 4.13
 

Sequence

CDS
ATGGACGCTGTGCCAAAGTTCACGGGTGATGACATCACGTACTCTTCTGCGAAGTGGACACAAGATCTCGACGATAATGCCGATATATTTGGGTGGAGCCAGCAGCAGAAACTCATTATAGCGCGACGATGTTTAGCTGGAACAGCAGAATTATGGCTAAAAAGCGAAAAAACTTTCAGAAGTTACGAAGAACTAAAAGTGGCTTTGATGAAGGAATTCCCTGAGGTGATAAACAGTAAACAAATGCATGAGACAATGAGCAGACGGAAAAAACAACCCAATGAGTCGTTTTATCAATATATGCTCGTAATGAAAGAACTCGGAAAAAGAGCTAAGTTTCCGGATTACGTCGCGATTCAGTATATAATCGACGGAATATCTGACTATGAATCTAACAAGTTGTTATTTTACGGGGTAACGTCGTATTCTGTGCTCAAGGAGAAATTAGTATTATATGAAAGTTTCAAAGAGAAGTCCAAAAAAAGTGTTGATACCATGAGACGAGGTCAGCGAGACACGGCGGTAATGCCTAGACAGGTTCATCGATGTTACAATTGTGGTGAAAGAGGGCACCTATCTAATTCCTGCCGCAGAGGTATCAAATGCTTCAAGTGCAACGGGTTCGGGCACAAGGGTACGGAGTGCCGCGCATCACAAGGTATGGAAGCTAAAAAAGCATCAAATAATTATTATGGAGGAGGTGATGAACAAGATCGGCGATCTATGTTTGTTCGACAGCAGGAGGACGACGAGAAGAACGAGAACGAACTATACGAACGTGAGCAATGCGATTTAAAAGAGCAAGTGAGTGATATGCCAAATTTTAGTTGTCAACAACTAAATCATATTGTTTCGTCAAATTTATTAAATGTAAACAAACGTGATTCTATAAACATGAGTGTAAAATCAGTAAAAGTTGGTAACTATGTGACTAATTGTTTAATTGACACAGGTAGCGACTTAAATTTAATAACTTTTGATTTGTTTACAAAACTAAAATGCGAGTACATACCAGAAAAAATGTTGCTTACTGGGTTAGGAAGCTCTAAGGTATATTCGATTGGTAAGTTCGACACAGATTTAACTATTGACAGTCACAGATATAGTATTAATTTGTATATTGTACCTACAGGTGGAATACCATATGATGTAATACTGGGTCAACAATTTTTAGTAAATACTATCACAGTTATTGACAAGGGTTTGGTTGAGGTCAGGCCTCCTTGTTATGACATATCGTATCAAAATGCTATCTGTCTATCTTCTAGTAGCAATGACCAGTGTACAGCGGTGAGGGAAATTATTGACAGTTACACACCTTTGAAGACTAAAGATGCACCTATCAGGCTGAAGATTGTGTTGAAGGATGATGTACCAGTTTCACAAAGACCAAGACGACTAGCCATCACTGAAGAACAGTTAGTTAAGCAGCATGTTGATGCATTGAGCAGAAACATACTTTTCACTGACCGAGGTACAGCATTCACAGGCAGTGAGTTCCGAGAATATTGTGAAGAAGAAGACATCGAACATGTTACAATCACTACTGGAATACCTCGTGGAAATGGCCAAGTAGAACGCATGAACAGTATTATTATTTCTGCGTTGACAAAGATGTGTATTGAAGAACCTGGTCACTGGTACAAATATACAAGCAAACTACAACAAGTGATAAACAGCACATACCAGCGGGCAATCTGTACTACGCCATTCGAACTGTTAACAGGAGTGAAACTTAAACTGAAAGAAGATTTATCAATTTTAGAATATTTAGAAGAAGAAAATAGATTGCAATTTATGAATAGGAGAGAAGAAGCACGAAGAGAAGCCAAAGCTCAAATTTTAAGAATGCAAGAGGAGAATAGAAAGACTTATAATAAACGACGTAAAGTAGGAGAAATGTACAAGGTTGGAGATCTTGTAGCTATTCAAAGGACACAATTTGGGAACGCCCTAAAATTGAAACCTAAATTTTATGGACCATATCGCATCACTAGGGAAATGGGGAAAGGTCGATATGAGGTCGAAAAAATAGACAGAAGCAAAGATGGGCCAGTACGAACTACATCAGCATTAGATTTCATGAAGAGGTGGCCTTGA
Protein
MDAVPKFTGDDITYSSAKWTQDLDDNADIFGWSQQQKLIIARRCLAGTAELWLKSEKTFRSYEELKVALMKEFPEVINSKQMHETMSRRKKQPNESFYQYMLVMKELGKRAKFPDYVAIQYIIDGISDYESNKLLFYGVTSYSVLKEKLVLYESFKEKSKKSVDTMRRGQRDTAVMPRQVHRCYNCGERGHLSNSCRRGIKCFKCNGFGHKGTECRASQGMEAKKASNNYYGGGDEQDRRSMFVRQQEDDEKNENELYEREQCDLKEQVSDMPNFSCQQLNHIVSSNLLNVNKRDSINMSVKSVKVGNYVTNCLIDTGSDLNLITFDLFTKLKCEYIPEKMLLTGLGSSKVYSIGKFDTDLTIDSHRYSINLYIVPTGGIPYDVILGQQFLVNTITVIDKGLVEVRPPCYDISYQNAICLSSSSNDQCTAVREIIDSYTPLKTKDAPIRLKIVLKDDVPVSQRPRRLAITEEQLVKQHVDALSRNILFTDRGTAFTGSEFREYCEEEDIEHVTITTGIPRGNGQVERMNSIIISALTKMCIEEPGHWYKYTSKLQQVINSTYQRAICTTPFELLTGVKLKLKEDLSILEYLEEENRLQFMNRREEARREAKAQILRMQEENRKTYNKRRKVGEMYKVGDLVAIQRTQFGNALKLKPKFYGPYRITREMGKGRYEVEKIDRSKDGPVRTTSALDFMKRWP

Summary

Pfam
PF00098   zf-CCHC        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF02037   SAP
PF03732   Retrotrans_gag
PF00077   RVP
PF14392   zf-CCHC_4
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036361   SAP_dom_sf       
IPR041577   RT_RNaseH_2       
IPR003034   SAP_dom       
IPR005162   Retrotrans_gag_dom       
IPR018061   Retropepsins       
IPR025836   Zn_knuckle_CX2CX4HX4C       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF68906   SSF68906       
Gene 3D
PDB
3DLR     E-value=1.19676e-10,     Score=162

Ontologies

Topology

Length:
699
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00885
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00052
outside
1  -  699
 
 

Population Genetic Test Statistics

Pi
377.073923
Theta
167.841746
Tajima's D
3.369514
CLR
0
CSRT
0.991700414979251
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号