SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05786
Pre Gene Modal
BGIBMGA013783
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.168
 

Sequence

CDS
ATGGGTGAAATACTTATATACAACACACACACTCTCACTCACTGTCACACTGCCCGTGTAACAACTGAATACCTCGAAGAAGTCGATATCGCCACATTGGACTGGCCTGCGCTCAGCCCTGACTTGAATCCTATTGAGCACGTGTGGGATGAACTGAAGAGAAGGGTTCGTTCCAGAACTTCAGCTTCTTCATGCCTGAATGAGCTGAAATCGGCGTTGATTGAGAAGTGGGAAGGTATCCCACAAGAATCAATTCAAAAGCTGATCAGTAAATGCTGTGATGGTGTGTGTACTGAAGTAAATCACATAGTAGTTATAGATAAATTGTATACAGATATTGTAAATGCCCTAAGTGCAGCTGCATTGGACGGTCGGGAGGGCGCTGTAAAACGTGCTAGAAGAGTGGTAGTGGGCTGGAATAAGCATGTTGCCGAGGCTCACAGGGAAGCTAGGCAAAAGTTTTTGTTGTGGGTAGGGTACGGTAAACCTACTTCTGGGTATGCGTATAATGATATGTGTGAATCTAGAAAAGTTTTCAAGTCTAGACTAAAGTGGTGCCAAGATCATGAGGACCAAATAAAAATGGATATTCTAGCCTCACACCATTCTAAAAGTGATTTTCGTGGCTTTTGGAAACACACAAATAAATTAAAGAATAGGCCGACAATACCTGTGAGCGTCGGTGGCGTGAGTGAACCAGAACAAATTGCCAACATGTTCAAGGAACGCTTCTTTGTAAAATCTACTTTAGGACTCGCTGGGTCGGTGCTTGATATTGAGCACGGCAGGGAAATTGGAGTGGCATTTACGTCTAAGGATGTTAAAAAGACAATTAGGTCAATGTCACGTGGTAAGTCTCCGGGACATGACGGGCTCAGCATTGAGCACCTGCGTTATGCGGGCGTGCACATCTCTAGGGTTCTCTCAATGCTGTATAACATTTTTGTGGGTCATAGTTATTTGCCAAGGGAAATGATACGAACAGTAGTTGTACCAATAGCTAAAAATAAGACTGGAGACCTTGCAGATAGCAGTAACTATAGGCCTATCTCACTAGCTACTGTTATATCCAAAGTGTTGGACAGCATGCTTAACTTTAAACTAAATAAATATGTAAATCTTCATGATAACCAATTCGGATTCCGTTCAGGTTTGTCGACAGAGAGTGCAATCTTAAGTCTTAAGCATGCTGTCAAATACTACACGCGGCGAGGAACACCTGTTTATGCCTGCTTTCTTGATCTGTCCAAGGCGTTTGATTTGGTTTCCTATGACCTCTTGTGGAAAAAGTTGGAAAATATTAAACTACCCACGGAAATAAATAACATTCTAAAGTTTTGGTATGGGAACCAGATCAACAATGTGCGATGGGCTGGGGCTTTGTCTCTTCCATATAGGTTGGAGTGCGGGGTGAGACAAGGCGGGTTGAGTTCGCCTACGCTCTTCAACCTGTATATGAACGAGCTGATCGGCGAGCTCAGTAGGACCAGGATTGGTTGTTTCATAGACGGGGTGTGCGTAAACAACATCAGCTACGCAGACGATATGGTGCTGCTGAGCGCGTCTATCTGTGGCCTAAGGCAACTTGTTTCTTTGTGTGAGGGATACGCCAAATCACACGGTTTGGTGTACAACTGTAAAAAGTCGGAGATCATGGTCTTTGAGACCAGGGGTGGGACGCATGATAAAATACCTCCCGTAGTACTCAACGGAACGCCATTGACAAGAGTTTATAAATTTAAATATCTCGGCCATGTGTTGACCCCTGATCTCAAAGATGATGAAGATATTGAACGAGAGCGGAGAGCATTGTCGGTTAGAGCAAACATGATAGCTCGCAGGTTTGCACGGTGTTCACTTAAAGTCAAGGTCACCCTCTTTAGGGCCTACTGTACTAACTTTTACACGTGCAGCTTGTGGGCTGGATATACTCAAAGATCATACAATGCTCTCCGTGTTCAATACAATAACGCGTTTAGGGTGCTGGTGGTGCTGCCCCGCTTTTGTAGCGCATCAGGGATGTTTGCAGACGCGCACATAGATTGTTTTTACGCTACCATGCGTAAGAGGTGTGCATCTCTGGTAAACAGAGTGAGGGCCAGCTCCAACAGTATCCTGAGCATGATCGCAAGCAGGCTGGACTGTATATACATGGGTCGCTGTGGTGCCATCTCCCATGGGATGTTACCACAATTCGTTTATCGTACCATTAAACGATACAATGAAGACTCTAGTGTAGATGACAGGTTAGGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCGAATCCAAAGAAATCCCAAACGTAAGCAGAAACTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAGTGAAGACTTAGGGCTTCGGGCATATCGAAGTAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGTACGCGGGAAAAAAATATCGGGAAATTCTTTTTTCGGATGAAAAAATTTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGCGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCATGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAACAAACTTTAGTGTCATAA
Protein
MGEILIYNTHTLTHCHTARVTTEYLEEVDIATLDWPALSPDLNPIEHVWDELKRRVRSRTSASSCLNELKSALIEKWEGIPQESIQKLISKCCDGVCTEVNHIVVIDKLYTDIVNALSAAALDGREGAVKRARRVVVGWNKHVAEAHREARQKFLLWVGYGKPTSGYAYNDMCESRKVFKSRLKWCQDHEDQIKMDILASHHSKSDFRGFWKHTNKLKNRPTIPVSVGGVSEPEQIANMFKERFFVKSTLGLAGSVLDIEHGREIGVAFTSKDVKKTIRSMSRGKSPGHDGLSIEHLRYAGVHISRVLSMLYNIFVGHSYLPREMIRTVVVPIAKNKTGDLADSSNYRPISLATVISKVLDSMLNFKLNKYVNLHDNQFGFRSGLSTESAILSLKHAVKYYTRRGTPVYACFLDLSKAFDLVSYDLLWKKLENIKLPTEINNILKFWYGNQINNVRWAGALSLPYRLECGVRQGGLSSPTLFNLYMNELIGELSRTRIGCFIDGVCVNNISYADDMVLLSASICGLRQLVSLCEGYAKSHGLVYNCKKSEIMVFETRGGTHDKIPPVVLNGTPLTRVYKFKYLGHVLTPDLKDDEDIERERRALSVRANMIARRFARCSLKVKVTLFRAYCTNFYTCSLWAGYTQRSYNALRVQYNNAFRVLVVLPRFCSASGMFADAHIDCFYATMRKRCASLVNRVRASSNSILSMIASRLDCIYMGRCGAISHGMLPQFVYRTIKRYNEDSSVDDRLGSGRPRSVRTPAVIKAVKARIQRNPKRKQKLLALQMGLSRTTVKRVLSEDLGLRAYRSKTGHRLNARLMDLRLKRCRALLKRYAGKKYREILFSDEKIFTVEESYNKQNDKVYAHSSEEASNRIPRVQRGHFPSSLMVWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTNLAEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFEQTLVS

Summary

Uniprot
ProteinModelPortal
PDB
5HOO     E-value=1.18324e-12,     Score=181

Ontologies

GO

Topology

Length:
1045
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14934
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00056
outside
1  -  1045
 
 

Population Genetic Test Statistics

Pi
153.011082
Theta
75.130307
Tajima's D
1.060037
CLR
0.782022
CSRT
0.677666116694165
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号