SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05757
Pre Gene Modal
BGIBMGA006804
Annotation
PREDICTED:_tyrosine_decarboxylase_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 1.065 PlasmaMembrane   Reliability : 1.412
 

Sequence

CDS
ATGGATGTCGAAGAGTTTCGTGTGCGCGGTAAAGAGATGGTAGATTACATATGCACTTACATGAACACGTTGCGTACCCGGCGCGTTGTGCCCAGCGTGGAGCCAGGATACCTACGAACAGCACTTCCGGCCGAAGCTCCTCATCACCCCGAACCCTGGGACGATGTGATGAACGATGTCGAGCAAAAGATAATGCCAGGTGTAACACATTGGCAGCATCCACGTTTTCACGCATACTTTCCGGCAGGCAACGGGTACCCTTCGATACTCGGAGATATGTTGTCTGCTGGCATCGGATGCATTGGTTTTTCCTGGGCAGCAAGTCCCGCCTGTACTGAGCTAGAAATAATCATGTTGGATTGGATGGGAAAAGCGATTGGACTACCGCCTGCCTTTTTAGCGCTTGAAGAAGGTAGCAAAGGGGGCGGTGTTATCCAGGGATCTGCTAGTGAATGCGTTCTTGTATCTATGTTGGCTGCCAGAGCCAATGGAATTAAAAGATTAAAGCATCAATTTCCCAATGTTGACGAGGGACTTTTGCTATCAAAATTAATAGCATATTGTTCTAAGGAAGCCCATTCATGCGTCGAAAAGGCAGCCATGATTTGCTTTGTGAAACTTCGTATCTTACAGCCGGATGACAACGGTTCTCTTAGAGGTGAAACACTAAAGGAGGCTATGGAAGAAGATGAAGAGGCAGGGCGAGTACCGTTCTTTGTCGCTACGACATTGGGGACTACTTCATGTTGCTCCTTCGATAATTTGCCTGAAATAGGTCCCATGGTGCGGAAATTCCCTTGCGTCTGGCTTCACGTGGACGCCGCATATGCTGGAAGCTCATTCCTCTGCCCAGAACACAAGTATCACTTAGCTGGAGTTGAATATGCTGACTCCTTCAATACTAATCCTAATAAATTAATGCTTGCGAGTTTTGACTGTTCACTATTGTGGGTCACTAACCGCTATCTTCTAACATCTGCCCTCGTGGTTGATCCGTTGTATCTACAACATTGCTACGACCACACTGCTATCGATTATCGACACTGGGGTATATCGCTTAGTCGTCGTTTCCGTTCGCTTAAGCTATGGTTCATGTTGAGAAGTTACGGTATTAGCGGCTTGCAAAAATATGTCAGAAAGCATTGCGAACTGGCCAAATATTTTGAAAGGCTTGTCAAGAAAGACGATAGATTCCAAGTCTGCAATCAAGTAAGGTTGGGTTTGGTTTGCTTCCGCCTCGTTGGAGGTCCCGACGAGACTCCGGAGCAAATTGATGAGATGAACAAGAAACTCCTCACTAATATAAATGCATCTGGAAAACTGCATATGGTCCCGGCCTCTGTTCGGGAACGTTTTGTGATACGTTTCTGTGTGGTCGCTCAGCACGCTACACGTGAAGATATTGAAGTTGCTTGGGATATAATATCCGACTTTGCTACGGAGTTATTAGAGGGTCCGGATAAGGAAAGGGATCTAAACGAGGAACGTACTCGTCGCAATCGTGCCGCTCTAGCCCACAAACGTTCGTTCTTCGTACGTATGGTTAGCGATCCAAAGATCTATAATCCGGCTATCAACAAAACTCCACCACCGGTAGCTACATCTCCTCCTGGGTCACCACCCGCTGCTGCACCTTCCACGCCAGATACTCCATCCGACTCTGGCTCCATTCAACAGCCCACTACGCCGAAGCAATCGTCTTGGATAAGCTGGCCTCTTGGATTCTTTTTCCAGAGCGTTGATCACGACTCTAACGATTTGCCACTGAGATTTCGTCATCTCGACACGATGGTGAGGTTGAAGAGTCCCGGAGCAAGTCGTCGGGGCTCCACGCCGTGCGCCTCACCCGAACATCGGGCCTCGTCGCCCTCCAACAATCACTAA
Protein
MDVEEFRVRGKEMVDYICTYMNTLRTRRVVPSVEPGYLRTALPAEAPHHPEPWDDVMNDVEQKIMPGVTHWQHPRFHAYFPAGNGYPSILGDMLSAGIGCIGFSWAASPACTELEIIMLDWMGKAIGLPPAFLALEEGSKGGGVIQGSASECVLVSMLAARANGIKRLKHQFPNVDEGLLLSKLIAYCSKEAHSCVEKAAMICFVKLRILQPDDNGSLRGETLKEAMEEDEEAGRVPFFVATTLGTTSCCSFDNLPEIGPMVRKFPCVWLHVDAAYAGSSFLCPEHKYHLAGVEYADSFNTNPNKLMLASFDCSLLWVTNRYLLTSALVVDPLYLQHCYDHTAIDYRHWGISLSRRFRSLKLWFMLRSYGISGLQKYVRKHCELAKYFERLVKKDDRFQVCNQVRLGLVCFRLVGGPDETPEQIDEMNKKLLTNINASGKLHMVPASVRERFVIRFCVVAQHATREDIEVAWDIISDFATELLEGPDKERDLNEERTRRNRAALAHKRSFFVRMVSDPKIYNPAINKTPPPVATSPPGSPPAAAPSTPDTPSDSGSIQQPTTPKQSSWISWPLGFFFQSVDHDSNDLPLRFRHLDTMVRLKSPGASRRGSTPCASPEHRASSPSNNH

Summary

Cofactor
pyridoxal 5'-phosphate
Similarity
Belongs to the group II decarboxylase family.
EMBL
NWSH01000887    PCG73682.1    KZ149900    PZC78592.1    KP657629    AKL78854.1    + More
ODYU01008299    SOQ51765.1    BABH01030961    BABH01030962    KQ460398    KPJ15019.1    KQ459302    KPJ01814.1    AGBW02010077    OWR49204.1    JTDY01000364    KOB77527.1    RSAL01000493    RVE41539.1    KQ971372    EFA10348.1    DS232080    EDS34186.1    CH477272    EAT45251.1    CH964282    EDW85561.1    CH916367    EDW01993.1    CH933808    EDW08946.2    CP012524    ALC42171.1    CH940648    EDW61660.1    CM002911    KMY91772.1    CM000157    EDW89072.1    AE013599    BT083414    AAM70812.1    ACQ89823.1    CH954177    EDV59802.1    ATLV01015292    KE525006    KFB40295.1    OUUW01000001    SPP74181.1    CH480816    EDW46643.1    CH479181    EDW31392.1    CH902619    EDV38125.1    CM000071    EAL24715.2    KRT01490.1    KRT01491.1    KRT01492.1    AXCN02000551    KRJ98161.1    UFQT01001786    SSX31809.1    AAAB01008807    EAA03914.4    GBXI01011171    JAD03121.1    JRES01000975    KNC26593.1    AB897807    BAO52000.1    GAKP01023480    JAC35478.1    ACPB03016005    GAMC01006647    JAB99908.1    KJ152556    AHN85839.1    CVRI01000059    CRL03346.1    APCN01000188    DS235239    EEB13798.1    GAMC01006646    JAB99909.1    KB632136    ERL89055.1    APGK01029452    APGK01029453    APGK01029454    APGK01029455    APGK01029456    APGK01029457    KB740735    ENN79134.1    GL440682    EFN65559.1    KZ288198    PBC33681.1    KQ976396    KYM92977.1    ADTU01011942    AXCM01001173    GL764129    EFZ18462.1    KQ977408    KYN02931.1    UFQT01002012    SSX32405.1    KQ435922    KOX68436.1    KK107088    EZA59791.1    QOIP01000008    RLU19843.1    GL448390    EFN84699.1    CCAG010011030    AJWK01020251    ABLF02041125    ABLF02041147    KQ981727    KYN36983.1    KQ982490    KYQ55775.1    KQ414582    KOC70868.1    QCYY01003481    ROT63152.1    GL888417    EGI61296.1    KK853042    KDR12158.1    BDGG01000004    GAU97503.1    PYGN01000033    PSN56849.1    JH430253    NEVH01014358    PNF27872.1    GEZM01089377    JAV57516.1    LJIG01002050    KRT84890.1    MUJZ01000708    OTF84103.1    MTYJ01000051    OQV18280.1    GDIP01190175    JAJ33227.1    GDIQ01029522    JAN65215.1    GDIQ01010107    JAN84630.1   
Pfam
PF00282   Pyridoxal_deC        + More
PF13358   DDE_3
PF01498   HTH_Tnp_Tc3_2
Interpro
IPR015424   PyrdxlP-dep_Trfase        + More
IPR002129   PyrdxlP-dep_de-COase       
IPR015421   PyrdxlP-dep_Trfase_major       
IPR015422   PyrdxlP-dep_Trfase_dom1       
IPR010977   Aromatic_deC       
IPR002492   Transposase_Tc1-like       
IPR038717   Tc1-like_DDE_dom       
IPR009057   Homeobox-like_sf       
IPR021115   Pyridoxal-P_BS       
SUPFAM
SSF53383   SSF53383        + More
SSF46689   SSF46689       
Gene 3D
PDB
3RCH     E-value=2.28233e-153,     Score=1393

Ontologies

Topology

Length:
627
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.341990000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01523
outside
1  -  627
 
 

Population Genetic Test Statistics

Pi
297.010825
Theta
195.034378
Tajima's D
1.712947
CLR
0.165922
CSRT
0.831158442077896
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号