SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05751
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.336
 

Sequence

CDS
ATGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGCTCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGATCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAGAAGGGGTCGCCCTCCGAACACCACGTTGAGCATCCCTCTCCCGTCTAGGCGCGCAAACACCTCCGCCGTTAGCCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGAAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCACACTCACTTAAAATCATTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCGATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCTGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGACTTCAAGCACCGGTCACCGTTCAGTCAGCCCTTCGTCGCAAGCGACGGGTTCACGAGTAA
Protein
MRSRPRHVTAGAPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFRRGRPPNTTLSIPLPSRRANTSAVSPITLFGQPIPWAPKVKYLGVTLDRRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAAHTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGLQAPVTVQSALRRKRRVHE

Summary

EMBL
KC165845    AFY12622.1    AB018558    BAA76304.1    U07847    AAA17752.1    + More
AB055391    BAB21761.1    KQ459580    KPI99178.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081101    AAC72919.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GALX01005300    JAB63166.1    GALX01005299    JAB63167.1    GGMS01013269    MBY82472.1    KQ971729    KYB24751.1    GGMS01004685    MBY73888.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    ABLF02014862    ABLF02014866    ABLF02061908    GGMR01019198    MBY31817.1    ABLF02003961    ABLF02059872    APGK01020047    KB740155    ENN81216.1    ABLF02008933    KQ973342    KXZ75569.1    ABLF02029215    ABLF02061876    APGK01045324    KB741033    ENN74747.1    ABLF02019349    ABLF02041900    GFTR01008038    JAW08388.1    KK113014    KFM59099.1    GBBI01004571    JAC14141.1    KB632361    ERL93526.1    ABLF02061874    NEVH01026085    PNF14941.1    ABLF02043973    NEVH01012084    PNF30905.1    GFXV01006424    MBW18229.1    ABLF02041993    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    GBGD01000415    JAC88474.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    NEVH01007838    PNF34986.1    NEVH01010546    PNF32261.1    KK117880    KFM71667.1    NEVH01003017    PNF40781.1    GGFJ01001858    MBW50999.1    NEVH01000598    PNF43535.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    NEVH01000280    PNF43672.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01020071    PNF21969.1    PYGN01003315    PSN29591.1    NEVH01023962    PNF17612.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01013241    PNF29579.1    NEVH01026154    PNF14491.1    AF456125    AAL57609.1    NEVH01020963    PNF20308.1    AY180919    AAN87272.1    ABLF02066620    GGFJ01001857    MBW50998.1    NWSH01000032    PCG80497.1    GEZM01038405    JAV81653.1    GECU01015898    JAS91808.1    GEDC01000118    JAS37180.1    NEVH01017470    PNF24199.1    GEBQ01017345    JAT22632.1    NEVH01019376    PNF22596.1    GGMR01004707    MBY17326.1    NEVH01023961    PNF17613.1    PCG80496.1    ABLF02008463    NEVH01006721    PNF37225.1    GEBQ01019253    JAT20724.1    ABLF02033757    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    GBYB01007412    JAG77179.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    PYGN01000192    PSN51582.1    NEVH01026386    PNF14434.1    NEVH01017559    PNF23833.1    RPOV01000134    RPJ78669.1    GEZM01039082    JAV81425.1    GBGD01002174    JAC86715.1    GGFJ01002257    MBW51398.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    GGFJ01002256    MBW51397.1    NEVH01016327    PNF25684.1    S59870    AAB26437.2    GEZM01074951    JAV64378.1    JRES01000644    KNC29657.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
316
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.80294
Exp number, first 60 AAs:
0.0833900000000001
Total prob of N-in:
0.26448
outside
1  -  316
 
 

Population Genetic Test Statistics

Pi
72.67793
Theta
61.143088
Tajima's D
0.631017
CLR
0
CSRT
0.562521873906305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号