SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05685
Pre Gene Modal
BGIBMGA006413
Annotation
PREDICTED:_DNA_ligase_1-like_isoform_X3_[Monodelphis_domestica]
Location in the cell
Cytoplasmic   Reliability : 2.373
 

Sequence

CDS
ATGTGGTTTGTGAGTGGAGTTGTTAAGGTTAAAGAAGTTGAGAGGGAGATTATCGAGTTTAAAGGTAATAGAGTCAAGAAGGAGTTAAGGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAAGGTTAGAGGTCGAGAAGGAGTTAAAGAGGTTGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTAAAAGTTTTAAAAACTTGA
Protein
MWFVSGVVKVKEVEREIIEFKGNRVKKELRVRVEKELKVRVEKELKVRVEKELKVRGREGVKEVEKAFKVIKEVEKAFKVIKEVEKAFKVIKEVEKAFKVIKEVEKAFKVIKEVEKAFKVIKEVEKALKVLKT

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
133
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.12460
outside
1  -  133
 
 

Population Genetic Test Statistics

Pi
273.838373
Theta
158.920779
Tajima's D
2.273803
CLR
0
CSRT
0.92190390480476
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号