SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05650
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.853
 

Sequence

CDS
ATGTCGTCAGGTAGTTATTTATTAAATGTGCCGAAATTAAAAGGACGCGAAAATTATGACGACTGGGCATTCGCAGCAAGAAACTTTCTTATCTTGGAAGGCATAGACATCGACGCCATTCCGGTTGATTTGAGTCATGCCGAAGACCGAAAAGCGAAAGCAAAACTCGTCATGACCATTGATCCCAAGCTATATGTGCACATCAAAAATGAAACCAAAGTCAAGGATTTGTGGCAGAAACTACAAAAGTTATTCGATGACAGCGGGTTCACAAGAAAAATCAGCCTACTTCGAACACTGATATCCATTCGACTTGATAATTGTGAATCCATGACAAGTTACGTAAGTCAGATAGTGGAAACTGCACAAAGACTAAAAGGTACAGGGTTTGAAATTAATGAGGAATGGATCGGATCATTGCTGTTGGCGGGGCTGCCAGAAAAGTTTGCCCCGATGATTATGGCAATAGAACATTCCGGAATTGCCATAAATTCTGATGTCATAAAAACCAAATTGCTTGATATGAGTTCTGAGGTAGGTGACCATGACTCAGAAATTGCATTATGGTCGAAACAAAAACAAAGGGTAGAACAAAATTTTAATAAAAAATTTGAAAAACCAACTTCAAATTACACGCAAAATGTAAAAAAGATTATAAAATGCTACAAGTGCAAGAAAATTGGCCATTTTAAGAATCAGTGTCCTGAATTGAAAGAAAAGCAAGTAAACGCATTTAGTGCTGCTTTTTTTCATAGTGAATTTAATAGGGAAGACTGGTATATCGACTCAGGGGCTAGTGCTCATATGACATCAAGCAAAGAAAACTTATTGCAAGTGAGAAAAGTACACGATATGAAGGAAATTATTGTTGCAAATAATATGACTGTGCCAGTAGTGTGTGCCGGAAATTCACAGATTACTACTGTTGTGAATAATTCTCAGTTTGATATTAAGGTAAACAACATTTTATACATACCTAATCTAACAACAAACTTATTGTCAGTAAGCCAGTTGATAGCAAGAGGAAACAAAGTTTCTTTCAAAAGTGATGTATGTTATATACATAATCAACGAAATGAGCTTATTGGAATAGCAAATCTACAAAATGGTGTGTATAAGTTGAATACAGTAAGATCAGAGAAAGTGTTGGCGGCAGCAGTTCAGACTACAGATGCAAAACAGTGGCACAGTAGATTGGGACACATTAATAGTAATGATTTGCAGAAGATGAAAAATGGTGCTGTAGACGGAATATCGTTTGATATGAAGGCTAATATAAAAAAATCCAACTGTCAAGTATGTTGTGAAGGGAAACAGAGTCGTTTACCGTTCCAATTACGAAACCATAGAAGTACAGAATTGCTAGATTTAGTTCACTCAGATCTGTGTGGGCCTATGGAGGTTCGATCGATTGGACAGGCAAGATATTTTCTATTGTTTGTTGACGATGCTAGCAGGATGGCTTTTGTATATTTTATAAAGGAGAAGAATCAGACTCTACAGCGTTTCAAGGAATTTCAAAAAATGGTTGAGAATCAAAAAGGAACAAAGATAAAAACATTGAGAACCGACAATGGAGGGGAGTTTTCTTCAGATATGATGGAAAATTATCTGATAGATAGTGGAATTATCCATCAGAAGACGAACCCATATACTCCGGAGCAGAATGGTCTCAGCGAACGTTTCAACAGGACTATAGTTGAACGTGCAAGATGTTTATTGTTCGAGGCCAAACTGGATAAAAGTTTTTGGGCAGAAGCAGTTAACACGGCAGTATACTTGAAAAATAGATCACCGGCTTCAGGTTTGGACCAAAAGACACCGATTGAAGTATGGACAGGACAAAAACCTGATCTCAGTCATGTCAGAATATTTGGGAGCCCAGTAATGATGCATGTTCCTAAAAATAAAAGATTGAAATGGGACAAGAAAGCAGTTCAATTCATATTAGTGGGGTATCCAGAGAATGTGAAAGGCTACAGATTGTATAACTTAGAAACTAGAAAAATATGTACCAGCAGAGATGTCATTGTAATGGAACCAGATACTACTCAAATAGAAATAAACGAAGGACAGATAGAAAAACAGCAGTTAGCACAAGAGGAAAGTTCTACTGAAGAAAGTGAAATAACATTGACAAATCAGGATGATCCCACTTATGTATATGATTCAGAAAAAAGTACAACTTCTACTGAAGGAGACTCTTATCAGACATTATCTGAAGAAGAAGAGCTATCTGAGAAAGAAGAGCCTCGATTGGTGGAAAAGCGTACCAGGAAACCTCCTGAAAGGTATGGTTTTACCAATCTTTGTATTTCAGATGAACCAGAGTCTCGGTTTGAAGACATAACTTATGATGAAGCTACCAACGGTCCAGAGAAAGACAAGTGGCAGCAGGCTATGTCTGATGAACTTCAAGCGTTTGAAGACAACCAAGCGTGGGAGATTGTTAAACAAGAGGAGGCAGATAGAGTAGTACAGTGCAAATGGGTGTTCAAGAAAAAGCTAGAAAGCAATAACAGTGTTAGGTATAGAGCTAGACTTGTAGCGAAAGGTTACACTCAGCAGCATGGAGTAGATTTTAACGAAACTTACTCACCAGTGCTTAGATACTCTACACTTAGACTTCTGTTTGCATTAAGTGTAAAATTTCATTTTGAAATCTTTCATCTTGATGTAGTTACAGCATTTTTAAATGGTTTTTTAACAGAAAATGTGTACATGTACGCACCTCCTAGCTTAAATTGTCCAAGTAATTGTGTTCTTAAACTTAAAAAAGCAGTTTATGGTTTGAAGCAGTCTGCTAGGGCATGGAATACCAGAATAAATGATTATTTAATAGACATGGATTATGTAAAGTCAGTTTCAGAACCATGTTTGTATAGTAAAAAATGTAAAAATGAGCAGATTATCATTGCAATATTTGTTGATGATTTTTTCATTTTTTCTAATAGTAAGACTATGACTAATGATTTCAAGAAAAAGCTAATGTCAAAATTTTAA
Protein
MSSGSYLLNVPKLKGRENYDDWAFAARNFLILEGIDIDAIPVDLSHAEDRKAKAKLVMTIDPKLYVHIKNETKVKDLWQKLQKLFDDSGFTRKISLLRTLISIRLDNCESMTSYVSQIVETAQRLKGTGFEINEEWIGSLLLAGLPEKFAPMIMAIEHSGIAINSDVIKTKLLDMSSEVGDHDSEIALWSKQKQRVEQNFNKKFEKPTSNYTQNVKKIIKCYKCKKIGHFKNQCPELKEKQVNAFSAAFFHSEFNREDWYIDSGASAHMTSSKENLLQVRKVHDMKEIIVANNMTVPVVCAGNSQITTVVNNSQFDIKVNNILYIPNLTTNLLSVSQLIARGNKVSFKSDVCYIHNQRNELIGIANLQNGVYKLNTVRSEKVLAAAVQTTDAKQWHSRLGHINSNDLQKMKNGAVDGISFDMKANIKKSNCQVCCEGKQSRLPFQLRNHRSTELLDLVHSDLCGPMEVRSIGQARYFLLFVDDASRMAFVYFIKEKNQTLQRFKEFQKMVENQKGTKIKTLRTDNGGEFSSDMMENYLIDSGIIHQKTNPYTPEQNGLSERFNRTIVERARCLLFEAKLDKSFWAEAVNTAVYLKNRSPASGLDQKTPIEVWTGQKPDLSHVRIFGSPVMMHVPKNKRLKWDKKAVQFILVGYPENVKGYRLYNLETRKICTSRDVIVMEPDTTQIEINEGQIEKQQLAQEESSTEESEITLTNQDDPTYVYDSEKSTTSTEGDSYQTLSEEEELSEKEEPRLVEKRTRKPPERYGFTNLCISDEPESRFEDITYDEATNGPEKDKWQQAMSDELQAFEDNQAWEIVKQEEADRVVQCKWVFKKKLESNNSVRYRARLVAKGYTQQHGVDFNETYSPVLRYSTLRLLFALSVKFHFEIFHLDVVTAFLNGFLTENVYMYAPPSLNCPSNCVLKLKKAVYGLKQSARAWNTRINDYLIDMDYVKSVSEPCLYSKKCKNEQIIIAIFVDDFFIFSNSKTMTNDFKKKLMSKF

Summary

EMBL
GEZM01011856    JAV93393.1    AGBW02009826    OWR49812.1    GEZM01011857    JAV93390.1    + More
GALX01001351    JAB67115.1    KQ460297    KPJ16236.1    LBMM01004924    KMQ91985.1    KQ459875    KPJ19636.1    GEZM01011858    GEZM01011854    JAV93389.1    GEZM01011855    JAV93396.1    NWSH01002292    PCG68657.1    PCG68658.1    NWSH01000816    PCG74073.1    GEZM01011859    JAV93384.1    GBXI01011094    JAD03198.1    KQ460882    KPJ11482.1    GAKP01015352    JAC43600.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    NEVH01019375    PNF22597.1    NEVH01002725    PNF41351.1    NEVH01006721    PNF37230.1    NEVH01006980    PNF36330.1    KL367628    KFD61291.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    JYDJ01000808    KRX33413.1    JYDH01000330    KRY26802.1    DNYX01000353    HBK84078.1    JYDJ01000136    KRX42725.1    KL367553    KFD64618.1    GBHO01036544    JAG07060.1    GBHO01024949    JAG18655.1    GBHO01024951    JAG18653.1    GBHO01024947    JAG18657.1    GBHO01024950    JAG18654.1    GEZM01045163    GEZM01045162    JAV77888.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    AAZX01000499    GDHF01030254    JAI22060.1    LBMM01008124    KMQ89126.1    GBXI01002679    JAD11613.1    JYDQ01000379    KRY07987.1    KL367691    KFD60150.1    JXUM01099923    KQ564528    KXJ72133.1    GBXI01017107    JAC97184.1    LBMM01012645    KMQ86082.1    JYDU01000001    KRY01876.1    JYDL01000068    KRX18751.1    KL367527    KFD66146.1    KL367480    KFD71809.1    GEZM01050757    JAV75412.1    GFTR01008771    JAW07655.1    KRY26801.1    GGFM01000952    MBW21703.1    GGFM01000953    MBW21704.1    GGFL01004951    MBW69129.1    GEHC01000879    JAV46766.1    GBXI01007143    JAD07149.1    GAMC01018338    JAB88217.1    GEZM01017329    JAV90762.1    GEZM01017328    JAV90763.1    JYDP01000350    KRZ01021.1    LBMM01012464    KMQ86211.1    GAMC01020736    JAB85819.1    LBMM01012669    KMQ86061.1    GDHF01029191    JAI23123.1    JYDO01000104    KRZ71003.1    JYDM01000185    KRZ84108.1    OIVN01006239    SPD28653.1    CM007893    OTG30017.1    AC006248    AAD17409.1    EF094939    EF094940    ABO36622.1    ABO36636.1    AC149291    AAT38758.1    JYDP01000258    KRZ01816.1    JYDN01000113    KRX56900.1    NCKU01012701    RWS00004.1    GEDG01001927    JAP36462.1    GEHC01000878    JAV46767.1    NEVH01021933    PNF19227.1    OIVN01001130    SPC90232.1    KQ483989    KYP38573.1    KF740825    AIC77183.1    GEFH01000951    JAP67630.1    PSQE01000007    RHN45312.1    OIVN01000313    SPC78143.1    LBMM01011374    KMQ86881.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF07727   RVT_2
PF00098   zf-CCHC
PF13961   DUF4219
PF04500   FLYWCH
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036397   RNaseH_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR007588   Znf_FLYWCH       
IPR009056   Cyt_c-like_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
1C1A     E-value=0.00189348,     Score=102

Ontologies

Topology

Length:
1000
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.3842
Exp number, first 60 AAs:
0.00057
Total prob of N-in:
0.00025
outside
1  -  1000
 
 

Population Genetic Test Statistics

Pi
39.860176
Theta
142.176119
Tajima's D
-1.325357
CLR
139.542917
CSRT
0.0858957052147393
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号