SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05619
Pre Gene Modal
BGIBMGA006778
Annotation
PREDICTED:_uncharacterized_protein_LOC103942506_[Pyrus_x_bretschneideri]
Location in the cell
Nuclear   Reliability : 2.649
 

Sequence

CDS
ATGGTAGAGAGCCAGGAGGTGCTTTCCTATTTAATAGGAAAGCGTCGTTACGTCAAAGGCTCACTTACAAGACTCTATAACCAGTTGGGAGAAACCGAAAGACTGTCTACGGAAACTATACAATGCCGCTTAGAGCGTTGTGTTGTAGCGTTCCGCGAATACGGCGATTATTGCGGCCGAATTCTGGCAACTAACCCGGCTGATGAAGAGGATTCAGGTGAGTACGATGACAAATATTTTGGCATCATGGCTTGCTACCAAGCTGAGCTTAACAAGCGAAAGGCCAATGCTCCGCCTAATCCGACACCCCAAAAAAGGCTTATAAAGTTACCTACCATAGAAATGCCGCAGTTCACGGGTCAATATTCGAAATATATCACATTTAGAGAAATGTTCAAATCAGTTATCGAAAATGATGTTTCTTTAGATGACATTCAAAAACTGCATTATTTGCGATCATTTTTAAAGGAAGAACCTTTAGATTTAATAATTAATTTGCCTCTTATAGGGTCCAGCTTCAAGGAAGCTCTGAGGTTACTGGACCAGAGATATTATAATAAATATAATATAATGACAGAGCTTTTGTCTACATTGCTAGATCTAGATGTTATTAGTAAACCTTCTCCTAGCAATATAAGACATTTTGTGTCAACAATTAAACAAACGTTGGCTGCCCTCAAAAATATGGAGGCGAAGGTAGATGAATGGGATCCAATTTTAATGTTGATTTTGACCCGCAAGTTAGATGAACGTACAGCACGCGAATACCAACTGGATCGGGACAACACAATGGACCCCACTGTGGACCAGCTTCTAGCGTTCCTTGAAAAAAGAGCGCTCGCTATAGAGAATGCTGGACAATCCGCAGCCAAGTTGTTTACCACTAAAGTAGTCAACGCAGTGACCGCTAAGGAGAAGCGAGAATGTTACTTCTGTAAGTCAGTTGAACATAAGATTTATAACTGCAAAAATTTCAAACTTCTGCCTTCAGCGGAGAGAATATCTTTTGCACAAAAAAATGAGCTGTGCAATATATGTTTGAACAAACATCCAGGCAAGTGTAGGTTCTATTTTCGATGTGGTACATGCAAAAAAGGGCATGATTCATTGCTGCATCGCGAGGAAGAAAAGGCTGAAGCCGTTATTATGTTGTCTGGCAATAATGATAATAATGTTCTGATTCCCACAGCTCGTATAAAGGTCTTCAACAGTGATGGCAGGGAGGTGCGCATAAAGGCCATACTGGACTCCGCCTCTCAAGCTTCACTTATCACTACTAAGGCATTGAAGGTTTTAGGTTTGACTCCTAAGCGAGACAGTACTAATATTATAGGGGTCACGAATAACAAAAACCAAGTTCATTATTCTGTACCAATAGAAGTTCACTCGATGAAAACCCCATTCAAGGTTTCCATGAATTGTCATGTAGTGGACACGATAACATGCAAATTGCCACAGACCCCGATAGACCCATCCACAGTAGTTGTTCCAAAAAATATTCAGCTGGCCGATGATGAGTTTTATAAACCATCTGAGATTAATATGCTAATTGGAGCCAGTGTATTTTTTCAGGCACTGCTACCGGCGACGACCAACTCTACGTGCGCGACGCGCCGCCAGCCTCCAGTCGACCCGGCCAGCCAGAGTAAAGGAACGCCACAGATTATCAACACTAAATTTGGTCACATTATCGCGGGTGGTCTGCCACCTCAACATGAGGTAACGAAAATTGTTTCACTTTTATGTACATGTGAATCTGACATTGCTACTACCATAACTAAGTTCTGGGATACCGAAAAGGTTCCAGAAGCATTCCTAGAAAAGGATGCTGAGCATGACATAGTCGAGAATAACTTTAAGGCCACAGTTCAACTTTCGAATCATAGATTTCAAGTGGATTTGCCACTAAAGGTTCCCCTAAACGAGGTCAATGCGACATTAGGTGAATCGTTTGATCTTGCTCTATATAGATTTTTAAACCTTGAGAAAAAATTACATAAAAATATAAATTTATTGACAGATTATAAAAATTTCATACATCAATATGTTGACATGGGCCATGCTCACTTTGTAGACTTTCAGTCTTTTAATTTTGACTCGGACGCTATATATTTTTTACCCCATCATGCGGTGTTTAACGAGGCGAGCAAAACCACGCGCACACGTGTAGTTTTCGATGGTTCTATGAAGACAAAAAATAAAGTTTCACTCAATGACATTTTACTCAATGGTCCTATAGTGCAAAGAGATCTTTTCGAAATTATTACTTTATATAGGCTTGGCGACTACACGTTCAATAGCGATATTAAAAAAATGTTTAGGAATGTTATGGTCAATCCAGAATACACTACGCTGCAAAATATTTTGTGGCGCGATAGGCTTGATGAGCCAATTCGGTGCATTCGCTTAGATACTGTCACGTACGGCTTAAAATGCTCAAGTTACCTTGCAACCAGATGTCTGCTCGAGCTTGCAAACATGCATCAAGCTGACTTACCGTTAGCTTCTTTCATTAAAAAGAATTGTGTTTATGTTGATGATGTTTTATATTCGGATAACGATTTAACGGCTTTACATGAGGCGAAACAGCAGCTAAAACGTTTGTTAAGCTTGGGTGGCTTCCAAATGCATAAATGGTCGTCTAACTGCGATGAGATATTAGTTGATATTCCTTTCAATGAGAGACAGTTAGATGAAATTGAAGTTCAAAAAGAAAACAGCAGTATCAAGGCCCTAGGAATGACAATTGACGCAAAGAAAGATTGTTTTGTCATTAAATGCCCAAATAACTTTTCATTAAATTCTATATCAAAACGACAGATATTGAGTGACATTGCCAAATTATACGATCCTCTAGGCTTTGTCAGTCCGATTATAGTAAAGGCTAAGGTGATCATGCAGAAACTGTGGTGCGAGAAAGTGGACTGGGATGCTTGTCCACCACCGCAGGTAAGAGAGGAATGGACTGATTTTGCTACCAGCTTAGCGCAAATGGAACCTATATATTTGCAAAGAAACATTCAGGTCCCTGACGACGCCGAAGCAGTACAGATCGTCGGCTTCGCCGACGCTTCCAGCTCCACAGGCTACGGGGCTTGCTTATATCTGCGCGTAATAGATAAAGCAGGTAAAGTGACTGTCTCTTTACTCTGTTCGAAGTCTAGAATCAATCCGCGTAAGAAGTCCTTAACGGTTCCTAGGCTTGAATTAAACGCTATGCTGCTATTAGCAAAACTTACAGCCAAAATGTATGACACTCTCAAAATTAAAATTAAAATTGATGATGTTATTTTATTTTCTGATTCACAAATAGCTTTAGCATTGGCTCACACAGAAATTACTAAATTGCAAGCATATGTGGCGAACAGAGTAAAAGTAGTACAGCAGTTGACCAATAGATGGCACTGGGGATACGTCAGCACCCATGAGAATCCCGCAGATTACATAAGTCGAGGGCTAGGTCCACCAGAACTTCATTCCTGCTCTATGTGGTGGGACGGGCCTGAGTTCCTGCATAAAAGGGAGTATACATTTAGTCAAAACATACTGAAAGAAAACGCGGACAATCTACCCGAGATGAAGACAGCTCCTGTTGCTTCCACGTCCGCTGGTGTTATATTACTCACTCTGAAACAAAAAGAAATCTCACATATAATGAAGGCGACTTGTGCAAAGCAGCTGATGGGGTCTCTCCCTACACATCGTGTGACGCCCTCCAGAGCTTTCCAAGTTGTCGGTATAGATTATGCTGGGCCGATACAGATAAAAAACTCGAGAATTAGAAGAGCGTTACTAACTAAAGGTTACATTTGTATATTTGTCTGCTTTAATACCAAGGCGATTCACATCGAACTTGCCTCCGACTTGTCTACCGAAACGTTTTTAGCCTGCTTTAAAAGGTTTATTTCGCGACGCGGAATGCCCACCAACATCTATTGCGACAACGGAGGTGCCTTTAAGGGAGCAGCCAACCATCTAGTTGATTTGTACAGACTGAACAGCTCCAAAGATCATCAAACGCAGGTGCAAAATTTTTCTAATCGGCTTGGAATTAAGTTTAATTTTACACCAAGTTATTCGCCTGTGTTTGCTGGTCTGGCCGAGGCTGCAGTTAAAAGTATGAAATTTCATTTGAAACGGGTCTTACAGAAGATTGTACTTACATATGAACAATTGAATACGGTTTTGTGCCAAATAGAGGCGATTTTAAATTCTAGACCCTTGATGTCCGTTTCTACAGACATTACAGATTTCAGCTACCTCTCTCCAGGTCACTTCTTAGTGGGAGCTCCGCTCACTAGCTTCCCTGAACCAGATATCTCAGAAACGCCAGTTAATAGGCTTAGGTTTTGGCGGGGTTAG
Protein
MVESQEVLSYLIGKRRYVKGSLTRLYNQLGETERLSTETIQCRLERCVVAFREYGDYCGRILATNPADEEDSGEYDDKYFGIMACYQAELNKRKANAPPNPTPQKRLIKLPTIEMPQFTGQYSKYITFREMFKSVIENDVSLDDIQKLHYLRSFLKEEPLDLIINLPLIGSSFKEALRLLDQRYYNKYNIMTELLSTLLDLDVISKPSPSNIRHFVSTIKQTLAALKNMEAKVDEWDPILMLILTRKLDERTAREYQLDRDNTMDPTVDQLLAFLEKRALAIENAGQSAAKLFTTKVVNAVTAKEKRECYFCKSVEHKIYNCKNFKLLPSAERISFAQKNELCNICLNKHPGKCRFYFRCGTCKKGHDSLLHREEEKAEAVIMLSGNNDNNVLIPTARIKVFNSDGREVRIKAILDSASQASLITTKALKVLGLTPKRDSTNIIGVTNNKNQVHYSVPIEVHSMKTPFKVSMNCHVVDTITCKLPQTPIDPSTVVVPKNIQLADDEFYKPSEINMLIGASVFFQALLPATTNSTCATRRQPPVDPASQSKGTPQIINTKFGHIIAGGLPPQHEVTKIVSLLCTCESDIATTITKFWDTEKVPEAFLEKDAEHDIVENNFKATVQLSNHRFQVDLPLKVPLNEVNATLGESFDLALYRFLNLEKKLHKNINLLTDYKNFIHQYVDMGHAHFVDFQSFNFDSDAIYFLPHHAVFNEASKTTRTRVVFDGSMKTKNKVSLNDILLNGPIVQRDLFEIITLYRLGDYTFNSDIKKMFRNVMVNPEYTTLQNILWRDRLDEPIRCIRLDTVTYGLKCSSYLATRCLLELANMHQADLPLASFIKKNCVYVDDVLYSDNDLTALHEAKQQLKRLLSLGGFQMHKWSSNCDEILVDIPFNERQLDEIEVQKENSSIKALGMTIDAKKDCFVIKCPNNFSLNSISKRQILSDIAKLYDPLGFVSPIIVKAKVIMQKLWCEKVDWDACPPPQVREEWTDFATSLAQMEPIYLQRNIQVPDDAEAVQIVGFADASSSTGYGACLYLRVIDKAGKVTVSLLCSKSRINPRKKSLTVPRLELNAMLLLAKLTAKMYDTLKIKIKIDDVILFSDSQIALALAHTEITKLQAYVANRVKVVQQLTNRWHWGYVSTHENPADYISRGLGPPELHSCSMWWDGPEFLHKREYTFSQNILKENADNLPEMKTAPVASTSAGVILLTLKQKEISHIMKATCAKQLMGSLPTHRVTPSRAFQVVGIDYAGPIQIKNSRIRRALLTKGYICIFVCFNTKAIHIELASDLSTETFLACFKRFISRRGMPTNIYCDNGGAFKGAANHLVDLYRLNSSKDHQTQVQNFSNRLGIKFNFTPSYSPVFAGLAEAAVKSMKFHLKRVLQKIVLTYEQLNTVLCQIEAILNSRPLMSVSTDITDFSYLSPGHFLVGAPLTSFPEPDISETPVNRLRFWRG

Summary

EMBL
ABLF02022040    ABLF02056888    GFTR01008874    JAW07552.1    GGMR01015704    MBY28323.1    + More
GGMR01014413    MBY27032.1    ABLF02042264    KQ460500    KPJ14270.1    GBBI01004211    JAC14501.1    GGMR01020322    MBY32941.1    KQ460211    KPJ16510.1    GGMR01018506    MBY31125.1    ABLF02016109    ABLF02016113    ABLF02042806    ABLF02026305    GEHC01000870    JAV46775.1    GGMR01017803    MBY30422.1    ABLF02023723    LBMM01008464    KMQ88855.1    KQ459312    KPJ01687.1    ABLF02018588    ABLF02018590    ABLF02042430    ABLF02007122    ABLF02033517    GGMR01013586    MBY26205.1    KQ460545    KPJ14069.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    KQ458793    KPJ04955.1    KQ460036    KPJ18393.1    GEHC01000865    JAV46780.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    GGMS01005792    MBY74995.1    GGMR01020500    MBY33119.1    ABLF02004142    ABLF02023842    ABLF02028949    ABLF02058391    GGMS01010815    MBY80018.1    ABLF02041505    ABLF02041590    ABLF02041614    GBGD01000063    JAC88826.1    GGMR01011131    MBY23750.1    GFTR01008866    JAW07560.1    GEZM01066272    JAV68024.1    GGMS01006802    MBY76005.1    GGMR01010723    MBY23342.1    ABLF02022815    GAMC01020552    JAB86003.1    GGMR01000448    MBY13067.1    GGMR01009860    MBY22479.1    ABLF02028417    ABLF02042407    ODYU01008608    SOQ52337.1    GGMR01002340    MBY14959.1    LBMM01011051    KMQ87060.1    GGMR01012316    MBY24935.1    LNIX01000036    OXA39969.1    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    GEZM01060254    JAV71154.1    GEZM01018629    GEZM01018623    JAV90127.1    AXCM01013330    GEHC01000877    JAV46768.1    GEZM01078370    GEZM01078366    GEZM01078363    JAV62757.1    JXUM01113346    KQ565681    KXJ70776.1    ABLF02035780    ABLF02041762    GDUN01000087    JAN95832.1    ABLF02054908    GEHC01000869    JAV46776.1    LBMM01007770    KMQ89434.1    KQ460205    KPJ16960.1    GDUN01000088    JAN95831.1    GGMR01006575    MBY19194.1    LNIX01000007    OXA51382.1    LBMM01009688    KMQ87939.1    LBMM01012077    KMQ86420.1    NWSH01001201    PCG72150.1    GGMS01011369    MBY80572.1    LNIX01000003    OXA58579.1    GGMS01016389    MBY85592.1    GEHC01000894    JAV46751.1    GGMR01013370    MBY25989.1    LBMM01011516    KMQ86784.1    LNIX01000044    OXA38660.1    NWSH01001014    PCG73111.1    LNIX01000001    OXA61293.1    LBMM01007859    KMQ89359.1    ABLF02002658    ABLF02034765    ABLF02042453    ABLF02025193    ABLF02066034    LNIX01000002    OXA60848.1    LBMM01009645    KMQ87967.1    GEHC01000946    JAV46699.1    ABLF02008636    ODYU01012875    SOQ59395.1    LBMM01006490    KMQ90572.1   
Pfam
PF03564   DUF1759        + More
PF00665   rve
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00078   RVT_1
PF02145   Rap_GAP
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR005312   DUF1759       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR000727   T_SNARE_dom       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF111347   SSF111347       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1453
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0367300000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1453
 
 

Population Genetic Test Statistics

Pi
357.983236
Theta
213.25996
Tajima's D
2.262242
CLR
1.237653
CSRT
0.917254137293135
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号