SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05569
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.654 Nuclear   Reliability : 1.218
 

Sequence

CDS
ATGCACCCCGAGAGTGAGCTGCGGGCGCGGAGGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MHPESELRARRAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

Cofactor
FAD
Similarity
Belongs to the FBPase class 1 family.
Belongs to the GMC oxidoreductase family.
EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    LBMM01009501    KMQ88083.1    + More
LBMM01016102    KMQ84557.1    QOIP01000014    RLU15083.1    KZ149922    PZC77701.1    LBMM01005707    KMQ91279.1    KZ150386    PZC71062.1    QOIP01000009    RLU18544.1    KZ149896    PZC78733.1    KZ150308    PZC71477.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    LBMM01012027    KMQ86470.1    AB078931    BAC06456.1    AB078930    BAC06454.1    LBMM01006538    KMQ90523.1    AB078929    BAC06452.1    KZ149918    PZC77857.1    LBMM01006909    KMQ90209.1    LBMM01009494    KMQ88097.1    RSAL01000006    RVE54258.1    LBMM01003679    KMQ93242.1    ODYU01006757    SOQ48893.1    RSAL01003504    RVE40273.1    ODYU01009945    SOQ54696.1    PZC77700.1    LBMM01006022    KMQ91008.1    RSAL01000109    RVE47213.1    ODYU01004308    SOQ44039.1    LBMM01001564    KMQ96079.1    KQ414692    KOC63606.1    LBMM01008861    KMQ88580.1    RSAL01000014    RVE53298.1    ODYU01005282    SOQ45985.1    ODYU01008140    SOQ51495.1    LBMM01006996    KMQ90129.1    ODYU01006342    SOQ48109.1    LBMM01008682    KMQ88705.1    LBMM01024024    KMQ82631.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01019838    KMQ83439.1    ABLF02006132    LBMM01019839    KMQ83438.1    LBMM01005634    KMQ91349.1    QOIP01000013    RLU15211.1    LBMM01006657    KMQ90417.1    QOIP01000003    RLU25053.1    LBMM01003452    KMQ93523.1    QOIP01000031    RLU14697.1    QOIP01000010    RLU18098.1    LBMM01007036    KMQ90099.1    GGMR01011974    MBY24593.1    LBMM01004152    KMQ92762.1    LBMM01006671    KMQ90407.1    LBMM01004697    KMQ92167.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00316   FBPase
PF01421   Reprolysin
PF00732   GMC_oxred_N
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR033391   FBPase_N       
IPR000146   FBPase_class-1       
IPR028343   FBPtase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR011990   TPR-like_helical_dom_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF48452   SSF48452       
SSF51905   SSF51905       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
182
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01257
Exp number, first 60 AAs:
0.00175
Total prob of N-in:
0.10130
outside
1  -  182
 
 

Population Genetic Test Statistics

Pi
162.586419
Theta
117.529577
Tajima's D
1.559197
CLR
68.212592
CSRT
0.800909954502275
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号