SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05554
Pre Gene Modal
BGIBMGA006746
Annotation
_laccase-like_multicopper_oxidase_2_isoform_B_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.147 Nuclear   Reliability : 1.25
 

Sequence

CDS
ATGAATCCACTGGATGCTATTTGTGATGTGAAGCGGAACGACGCAGTATGTGTCAGCAATCTCAAGTCGGCAAGGCCCGTTGACAAAGCATTATTACAGGATCGACCGGACGTTAAAATATTTCTGCCATTTCGATTTCATTTTTACAAGCCAAAGGATCTTTTCAAGGAAAATACTTACAGAAATTTCTTAGTCGCCCCGGGTGGTGATCACGTGCTTAGTTTGGTAGACGAAATATCATACAGTGCTCCACCAGCACCTCCTTTGTCCCAAATGCACGAGCTCTCCCCGGACCTATTCTGTAATGGAGACAACAGACCTCCCAATTGCGCAGTCGACTGCCGTTGCACTCATATGATTGATGTTCCATTAAACTCTATAGTTGAGATTGTACTCGTTGATGAAGTGCAATCGCCAAACCTCTCACATCCGTTCCATCTCCACGGCACGTCGTACAACGTCATCGGCATGGGACGGTCCCCAGACAAGAATATCAAGAAAATAAACTTGAAACATGCTTTAGATTTAGACAGAAAAGGACTCCTCCACAGACAATACAACTTGCCGCCGCATAAAGATACTCTTGCTGTACCTAATAATGGATACGTTGTTCTGAGGCTCAAAGCTGATAATCCAGGTTATTGGCTCTTCCATTGCCATTTCATATACCACATAGTGATTGGCATGAGCCTGATATTACACATAGGAACACAAGGAGACTTACCACCTGTTCCACCGAACTTTCCCCGTTGTGGGCATCATCTACCGACCATCTCGCCACCGTTTTATCCGATACATTGA
Protein
MNPLDAICDVKRNDAVCVSNLKSARPVDKALLQDRPDVKIFLPFRFHFYKPKDLFKENTYRNFLVAPGGDHVLSLVDEISYSAPPAPPLSQMHELSPDLFCNGDNRPPNCAVDCRCTHMIDVPLNSIVEIVLVDEVQSPNLSHPFHLHGTSYNVIGMGRSPDKNIKKINLKHALDLDRKGLLHRQYNLPPHKDTLAVPNNGYVVLRLKADNPGYWLFHCHFIYHIVIGMSLILHIGTQGDLPPVPPNFPRCGHHLPTISPPFYPIH

Summary

Similarity
Belongs to the multicopper oxidase family.
EMBL
BK006378    DAA06287.1    BABH01008618    NWSH01003453    PCG66269.1    AGBW02010309    + More
OWR48757.1    KQ461198    KPJ06236.1    KQ459606    KPI91644.1    JTDY01000047    KOB79189.1    KQ971324    EFA01167.2    AY884062    AAX84203.2    NNAY01000189    OXU30149.1    JXUM01002789    KQ560145    KXJ84179.1    APCN01000048    APCN01000047    AXCN02000495    ATLV01024176    KE525350    KFB50921.1    AY943928    AAX49501.1    ADMH02001577    ETN62012.1    AXCM01006745    AAAB01008960    EDO63816.1    KY132102    ARG47519.1    GGFL01006686    MBW70864.1    DQ011288    AAY29698.1    DS232136    EDS35860.1    CH475903    EDY71185.2    PYGN01001776    PSN32866.1    AB586068    BAJ83488.1    EU886786    ACG63789.1    DS232661    EDS44514.1    GFDF01000470    JAV13614.1    GBYB01000178    JAG69945.1    MH253688    AWK23446.1    EDS35859.1    KB632063    ERL88452.1    APGK01023880    APGK01023881    APGK01023882    APGK01023883    APGK01023884    APGK01023885    APGK01023886    APGK01023887    KB740523    ENN80483.1    MH253687    AWK23445.1    CH477440    EAT40867.1    GDUN01000603    JAN95316.1    OUUW01000001    SPP75987.1    AY943929    AAX49502.1    CM000362    EDX05812.1    EAA11473.4    AB586067    BAJ83487.1    AB379590    BAG70891.1    EU093074    ABU68465.1    DS235860    EEB19131.1    LBMM01010299    KMQ87547.1    CH479181    EDW31272.1    KQ981756    KYN36122.1    GAKP01020651    GAKP01020650    JAC38302.1    KQ979709    KYN19417.1    GDHF01020306    GDHF01013149    GDHF01012944    GDHF01010584    GDHF01009008    JAI32008.1    JAI39165.1    JAI39370.1    JAI41730.1    JAI43306.1    GBXI01012310    GBXI01009830    GBXI01008054    GBXI01005511    JAD01982.1    JAD04462.1    JAD06238.1    JAD08781.1    LC202056    BBC20924.1    AJVK01008467    AJVK01008468    AY884061    AAX84202.2    EFA01166.1    KQ982450    KYQ56238.1    GAMC01012586    GAMC01012585    JAB93969.1    KZ288262    PBC30347.1    ADTU01006622    ADTU01006623    ADTU01006624    ADTU01006625    ADTU01006626    KJ789368    AII19522.1    CM002911    KMY91621.1    KMY91618.1    AE013599    BT010091    AAF57332.4    AAQ22560.1    CH480920    EDW43632.1    BT133179    AAF57331.3    AEZ68807.1    ACL83060.1    KQ435878    KOX69942.1    GL761667    EFZ22928.1    GL449511    EFN82585.1    CH940648    EDW61219.2    BT003483    AAO39486.1    GECU01015499    JAS92207.1    CH954177    EDV59896.1    CH891608    EDW99572.1    KK107024    EZA62287.1    CH475437    EAL29272.3    CH933808    EDW09743.1    QOIP01000004    RLU24055.1    EDW31271.1    KQ434943    KZC12283.1    GL888470    EGI60467.1    KQ414672    KOC64253.1   
Pfam
PF07731   Cu-oxidase_2        + More
PF00394   Cu-oxidase
PF07732   Cu-oxidase_3
Interpro
IPR011707   Cu-oxidase_3        + More
IPR008972   Cupredoxin       
IPR033138   Cu_oxidase_CS       
IPR002355   Cu_oxidase_Cu_BS       
IPR011706   Cu-oxidase_2       
IPR001117   Cu-oxidase       
SUPFAM
SSF49503   SSF49503       
Gene 3D
PDB
1ZPU     E-value=3.67276e-13,     Score=179

Ontologies

Topology

Length:
266
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
16.17992
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.67198
outside
1  -  266
 
 

Population Genetic Test Statistics

Pi
188.366781
Theta
184.766697
Tajima's D
0.122359
CLR
0.086793
CSRT
0.404579771011449
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号