SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05553  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006745
Annotation
laccase_2A_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 2.745
 

Sequence

CDS
ATGAAACAGACCGAAACGTTCAACCTTGTACTCCAGCTTAATACTTTTTTGCCTTTGATTTCAGAAGCCATCAACGCCGCAGACGACCAGTCCACATCGGCATCGTGGTGGCAAGCCGGGACAGCAACACCGTTCAGGGAAACGGGCAGTAATGCGTTCTCATCCACCCATGGACTCGTTCAAACACACCCCAGCGCTGATGATCCATTCGGAACTACTTTTGGAGGAATAGGAAGTACTATAGGACCGTCATCGAATCCCTTCGCTAAAAGCGGCAGCGGTCCGCTGAGTGGAGGCGTTAGGAAGAATCCTTTGCCATCTCTAGCCAGGATCTCTAACATTAACGGAAAAGCCTCATTGAAACATTTGGATTTTACTAGTAGTGCTACCGCTGAATTGAGAAGGAACCCAGCACTGTCGGCCCCTGATGAGTGTGCCAGAGCCTGCAGGGAAAACGAACCACCAAGGATCTGTTACTATCATTTCACATTGGAGTTTTATACTGTCTTGGGAGCGGCTTGTCAAGTATGCACACCAAACGCTACGAATGTGGTCTGGTCTCATTGCCAATGCGTACTGGCCGATGGCGTCGAACGGGGTATTCTCACTGCCAACAGAATGTTACCAGGCCCTTCCATTCAAGTTTGCGAAAACGATAAAGTGGTAATTGACGTAGAGAACCATATGGAAGGTATGGAGGTGACAATCCATTGGCACGGTATTTGGCAAAGGGGATCACAATATTACGATGGTGTACCGTTTGTCACGCAATGTCCTATTCAGCAAGGGAATACTTTCAGATATCAATGGCAAGGTAATGCTGGCACTCACTTCTGGCACGCTCACACTGGACTACAGAAACTGGATGGTTTATACGGCAGCATTGTCGTTCGTCAACCTCCTTCAAAAGATCCCAACAGTCACTTATACGATTACGATTTGACCACACACGTCATGTTGATCAGTGACTGGCTCCACGAAGATGCCGCTGAAAGATACCCAGGACGTTTAGCTGTCAATACTGGACAGGACCCCGAATCTGTATTGATCAACGGAAAAGGACAATTCAGAGATCCTAACACTGGCTTCATGACCAATACTCCATTGGAAGTTTTCACAATTACTCCTGGTAGACGTTACAGGTTCAGAATGATCAATGCCTTTGCATCGGTATGCCCTGCTCAAATCACGTTTGAAGGTCACAACTTGACAGTTATTGCTACTGACGGTGAGCCAGTGCAACCCGTGCAAGTGAACACGATAATCTCGTTCTCAGGGGAACGATACGACTTTGTAATCGAAGCTAACAACATTCCCGGAGCATACTGGATCCAAGTTCGAGGTCTTGGTGAATGTGGTATTAAGAGAGCACAACAATTAGGTATCCTCAGATACGCTAGAGGACCTTACCAACCATCTTCGCTGGCCCCCACCTACGATGTCGGAATACCCCAAGGAGTGGTGATGAACCCCTTGGACGCGAGATGTAATATATCAAGAAACGATGCTATTTGCGTGAGCCAATTGAAAAACGCTCAGAACATCGACCCCGCCATCCTTCAGGAGAGACCCGACGTTAAAATCTTTTTGCCCTTCCGATTCTTCGTATACAGACCAGAGATGCTCTTCCAACCCAACACATACAACAGATACTTGGTTGCCCCTGGAGGAGACCACGTTATCAGTTTGATTGACGAAATCTCATATATGTCCCCGCCTGCTCCATTGATCAGTCAGTATGATGACATCAATCCTGACCAATTCTGTAATGGAGACAACCGACCCGCTAACTGTGGACAAAACTGCATGTGCACACACAAAGTTGACATACCTCTGAATGCTGTTGTGGAGATTGTATTGGTAGATGAAGTACAAATCGCGAACTTATCTCATCCGTTCCACTTGCACGGATATTCATACAACGTGATAGGTATCGGAAGATCACCCGACCAGAACGTTAAGAAAATTAACTTGAAGCACGCACTCGACCTCGACAGAAGAGGATTGCTCGAACGTCACCTGAAGCAAGGAGACCTTCCTCCTGCAAAAGACACCATCGCTGTTCCCAACAACGGCTACGTCATTCTCCGTTTCAGAGCCACAAATCCTGGCTTCTGGCTACTCCATTGCCACTTCCTTTTCCACATCGTCATCGGAATGAGCTTGGTGCTCCAAGTAGGCACGCAGGGCGACCTTCCCCCCGTACCCCCGAACTTCCCCACATGCGGAGACCATCTCCCAGCCATCCCACTCCACTGA
Protein
MKQTETFNLVLQLNTFLPLISEAINAADDQSTSASWWQAGTATPFRETGSNAFSSTHGLVQTHPSADDPFGTTFGGIGSTIGPSSNPFAKSGSGPLSGGVRKNPLPSLARISNINGKASLKHLDFTSSATAELRRNPALSAPDECARACRENEPPRICYYHFTLEFYTVLGAACQVCTPNATNVVWSHCQCVLADGVERGILTANRMLPGPSIQVCENDKVVIDVENHMEGMEVTIHWHGIWQRGSQYYDGVPFVTQCPIQQGNTFRYQWQGNAGTHFWHAHTGLQKLDGLYGSIVVRQPPSKDPNSHLYDYDLTTHVMLISDWLHEDAAERYPGRLAVNTGQDPESVLINGKGQFRDPNTGFMTNTPLEVFTITPGRRYRFRMINAFASVCPAQITFEGHNLTVIATDGEPVQPVQVNTIISFSGERYDFVIEANNIPGAYWIQVRGLGECGIKRAQQLGILRYARGPYQPSSLAPTYDVGIPQGVVMNPLDARCNISRNDAICVSQLKNAQNIDPAILQERPDVKIFLPFRFFVYRPEMLFQPNTYNRYLVAPGGDHVISLIDEISYMSPPAPLISQYDDINPDQFCNGDNRPANCGQNCMCTHKVDIPLNAVVEIVLVDEVQIANLSHPFHLHGYSYNVIGIGRSPDQNVKKINLKHALDLDRRGLLERHLKQGDLPPAKDTIAVPNNGYVILRFRATNPGFWLLHCHFLFHIVIGMSLVLQVGTQGDLPPVPPNFPTCGDHLPAIPLH

Summary

Similarity
Belongs to the multicopper oxidase family.
EMBL
AB379590    BAG70891.1    EU093074    ABU68465.1    BABH01008618    KJ789368    + More
AII19522.1    AY135186    AAN17507.1    AGBW02010309    OWR48758.1    AB531133    BAJ07600.1    AB499123    BAI87829.1    ODYU01004678    SOQ44817.1    NWSH01003453    PCG66268.1    AB531135    BAJ07602.1    KF479388    AHA15412.1    BK006378    DAA06287.1    KQ459606    KPI91644.1    JTDY01000047    KOB79189.1    JF811457    AEP43806.1    ATLV01024176    KE525350    KFB50921.1    KY132102    ARG47519.1    AXCM01006745    DQ011288    AAY29698.1    AAAB01008960    EDO63816.1    APCN01000047    APCN01000048    AY943928    AAX49501.1    CH933808    EDW09743.1    EU886786    ACG63789.1    CH479181    EDW31271.1    CM002911    KMY91618.1    KMY91621.1    CH480920    EDW43632.1    CH940648    EDW61219.2    DS232661    EDS44514.1    DS232136    EDS35860.1    AE013599    BT010091    AAF57332.4    AAQ22560.1    BT133179    AAF57331.3    AEZ68807.1    CH475437    EAL29272.3    CH954177    EDV59896.1    CH902656    EDV29979.2    CH891608    EDW99572.1    KPU72643.1    UFQT01000078    SSX19430.1    BT003483    AAO39486.1    GAKP01020651    GAKP01020650    JAC38302.1    KA647757    AFP62386.1    GBXI01012310    GBXI01009830    GBXI01008054    GBXI01005511    JAD01982.1    JAD04462.1    JAD06238.1    JAD08781.1    GAMC01012586    GAMC01012585    JAB93969.1    JRES01000379    KNC31786.1    CH916367    EDW01968.1    GDHF01020306    GDHF01013149    GDHF01012944    GDHF01010584    GDHF01009008    JAI32008.1    JAI39165.1    JAI39370.1    JAI41730.1    JAI43306.1    KQ461198    KPJ06237.1    GDUN01000603    JAN95316.1    CH477440    EAT40867.1    AY943929    AAX49502.1    EAA11473.4    KMY91619.1    KQ971324    EFA01166.1    AY884061    AAX84202.2    AAN16124.2    ACL83060.1    KMY91622.1    MH253688    AWK23446.1    GEZM01020491    JAV89262.1    KMY91620.1    JXJN01000432    JXJN01000433    JXJN01000434    JXJN01000435    AGB93244.1    AXCN02000495    MH253687    AWK23445.1    KQS71051.1    AY884062    AAX84203.2    GGFL01006686    MBW70864.1    ADMH02001577    ETN62011.1    EU093075    ABU68466.1    CH963849    EDW74492.1    GAKP01020652    JAC38300.1    KQ435878    KOX69942.1    CVRI01000066    CRL05915.1    QOIP01000004    RLU24055.1    GBYB01000178    JAG69945.1    KQ434943    KZC12283.1    CH919043    EDW05139.1    GL761667    EFZ22928.1    KZ288262    PBC30347.1    KQ976741    KYM75596.1    KQ414672    KOC64253.1   
Pfam
PF07731   Cu-oxidase_2        + More
PF00394   Cu-oxidase
PF07732   Cu-oxidase_3
Interpro
IPR002355   Cu_oxidase_Cu_BS        + More
IPR011706   Cu-oxidase_2       
IPR001117   Cu-oxidase       
IPR033138   Cu_oxidase_CS       
IPR008972   Cupredoxin       
IPR011707   Cu-oxidase_3       
SUPFAM
SSF49503   SSF49503       
Gene 3D
PDB
5MIG     E-value=8.7223e-47,     Score=474

Ontologies

Topology

Length:
752
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.176
Exp number, first 60 AAs:
0.05991
Total prob of N-in:
0.01659
outside
1  -  752
 
 

Population Genetic Test Statistics

Pi
286.796102
Theta
228.00198
Tajima's D
0.86703
CLR
0.48847
CSRT
0.618269086545673
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25860555 QGDTQPIIVQK 95.24 1e-07
28467696 DPIVAQFAEFIHQGK 95.24 1e-07
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号