SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05549
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X4_[Bombyx_mori]
Full name
PiggyBac transposable element-derived protein 4      
Location in the cell
Nuclear   Reliability : 1.289 PlasmaMembrane   Reliability : 1.664
 

Sequence

CDS
ATGGAAAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATATACAGATTTCTGTACATGGCAGCCGTAGTCCTTCGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATATTACGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATTATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACTAAACCTCTTGTGACATCTTCCTCGCCTTCCATCATTTCAGCACCTACATCACCAGCTCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCGTGAATCTTTTAAGGAACACTCTGGTCCCACTGTCGCTGTAAGTGACCCTTACGAGATTTTTAGACTAATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATGTGAGTCGCAGACGGGGTATTTATGGCGATTTAAAATCCATGCCCATAAGGCTTCGCCTACAGTCTCAGAGGCTGATCCATTCACAGCGAGTACACCGGCGTTGGTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGGTACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAGTCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAAATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACAAGAAATTGTTTAAAAGTTATTATTAG
Protein
MERFNLIAIEDLPAGEPIEQALTERSTLNVAAVVRARHLLDIIYRFLYMAAVVLRRHINVCVDRFAQTKNMILRSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATKPLVTSSSPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKEHSGPTVAVSDPYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEICESQTGYLWRFKIHAHKASPTVSEADPFTASTPALVLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKSYY

Summary

Keywords
Complete proteome   Reference proteome  
Feature
chain  PiggyBac transposable element-derived protein 4
EMBL
KQ459989    KPJ18766.1    RSAL01001012    RVE40990.1    RSAL01000155    RVE45659.1    + More
RSAL01000045    RVE50637.1    ODYU01000749    SOQ36006.1    RSAL01000024    RVE52239.1    KZ150113    PZC73302.1    JTDY01002247    KOB71806.1    NWSH01005605    PCG64100.1    KZ150197    PZC72319.1    RSAL01000003    RVE54733.1    NWSH01005160    PCG64390.1    NEVH01017475    NEVH01002684    NEVH01001351    PNF24176.1    PNF41738.1    PNF42927.1    NEVH01026393    PNF14286.1    NEVH01021985    PNF18924.1    NEVH01026401    NEVH01025126    NEVH01020854    NEVH01013255    NEVH01000629    PNF14193.1    PNF16176.1    PNF21085.1    PNF29260.1    PNF43158.1    NEVH01009069    PNF34004.1    NEVH01026090    PNF14815.1    NWSH01008683    PCG62453.1    PZC73303.1    RSAL01000132    RVE46376.1    NEVH01011876    PNF31583.1    GEGO01007089    JAR88315.1    RSAL01000097    RVE47692.1    JU326601    AFE70357.1    AHZZ02030739    CM001259    EHH27175.1    CM001282    EHH62949.1    AK057200    AK094816    AK289491    AC079203    AQIA01062119    CABD030095328    JSUE03037923    ABGA01233763    NDHI03003689    PNJ08370.1    AQIB01116437    AACZ04060380    GABC01006592    GABD01003812    GABE01001690    NBAG03000487    JAA04746.1    JAA29288.1    JAA43049.1    PNI20010.1    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    GEGO01006047    JAR89357.1    CCAG010009903    GEBQ01012026    JAT27951.1    GEBQ01027849    JAT12128.1    KK120039    KFM77390.1    KK115494    KFM65244.1    GEDC01003168    JAS34130.1    NEVH01018384    PNF23441.1    GEDC01002971    JAS34327.1    GEBQ01017560    JAT22417.1    HAEI01002033    SBR78690.1    HAEH01008939    SBR85849.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       
IPR018159   Spectrin/alpha-actinin       

Ontologies

Topology

Length:
546
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19189
Exp number, first 60 AAs:
0.05902
Total prob of N-in:
0.00708
outside
1  -  546
 
 

Population Genetic Test Statistics

Pi
202.536632
Theta
156.03146
Tajima's D
-0.943668
CLR
1.139381
CSRT
0.145992700364982
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号