SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05543
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.102
 

Sequence

CDS
ATGCTTCGAGATAGACTGGTGTGCGGCATGAGCGATCATAAGCTTCAGTATGAGTTGTTGAAGAGAGAACAACTTCGTTATGAAGATGTTGTACATGCTATGGTATCATCGGAGAGCGCCGGAAAGGATGTGCGCATGATTCAAAGCACGAGCACGGACACATTTGGTATGACACAGGGTGAGGTAGTGACGTCACATGCCGAGCCTATGGAAGTGAATGTCGTCAATTTCAAACGTAATTTTCGACTGTGCTATCGCTGCGGAGACCGACACGGTGGAGAGTGTCGATATATTAATTCAATTTGTCATTATTGTAAGAAAAAAGGGCATATTGAAAAGATATGTACATCTAAGAAAAACAACAAAAGAAAGAGCATTAACTATACAGATGATGAATTTCAAGCGCAATTAAATGGTATTTACAACGTGAACACAAATAGTCGGCGCGTACCAGCTTACGAAGTAAAGGTGTTACTAGATGGTGTACCAGTGATTATGGAAGTGGACTCGGGTGCTGCCTACTCTCTTGTGAATTTACATACGTGGCGTCGAATACACTCTCACATGCCTTTGGAACCTTTGATGAATAAATTATGTACTTGGAATAATTCTGCAGTCAGAGTGGACGGTCAAGCCACAGTGCTAGTACAATATAAAGACATTAAATGTTCTCTTAAGGTTATTGTGGCTCAGGGTTCGGGTCCAAATTTGTTAGGACGTAATTGGTTTGAAGCTTTAGGAATATGTGTAAATGTAAATACTATTAAAGAAATTAATGTGACTGAGGTAATTTTGAATAAACATTATGAAGTTTTCAGAGCCGGACTCGGTACTTATCGTGGGGAACCTGTAAATATTCACCTGAAACCAGGTGCAGTGCCAAGATTTATGAAAGCGCGTCCTGTACCGTACGCTATCAAAGAAAGAGTTGAAAAAGAAATCAATCGCCTGGAAGCTGAAGGAGTACTCCGCCCTGTAACTTTTTCTGAGTGGGCTACTCCAGTTGTTCCTATCGTAAAAAAGAATGGAGACGTACGCCTTTGTGGAGATTATCGTAGTACAGTTAATCAGGCTACAGAGTCTGATACGTATCCAATGCCCACCGCAAGTGAAGTGTTTGCCACCATCTCTGGAGGTAATATTTTCTCAACGTTAGATCTTGATCGTGCTTATACTCAGGTGGTTGTCACAGACGACACAGCACGTCTCCTAACCTTAAACACATGTAAAGGCCTTTACACGGTACATCGGCTAGCTTTCGGCGTCAAGGCTTCCCCGGGTATATTCCAACGTTTAATGACAGCATTACTAGCTGGCATATCTGGTGTTGCAGTGCTAATCGATGACATCATCGTTAGTGGTAGAACAGCGCAGGAGATGACACAACGCTTAGATGCAGTCCTGGATCGCATTGAAAAAGCGGGATTACGACTCAATAAAGGCAAATGTAAGTTTGCAAGGAAACAAGTAGAATTTTTAGGTTTCATAATTGATGCTGAGGGTATACACCCTGCACCGAGTAAAATAGAATCAATATTGAAAACTCCCAAACCTAAGAACGTACAAGAGCTTCAAGCTTTTCTTGGCCTTTATAATTTTTATGAGAGATTTATTCCTCACAAAGCCACCATACTTGAACCTTTACATAGATTGCTAGACAAAGCACATAAGTGGCAGTGGTCAGAACGGGAACAGAAAAGTTTCGAGGTAGCAAAACGTTTGTTGTCCTCAGAGTTAACCTTAGCTCATTATGATCTTGAAAAACCTTTGATACTTACCTGTGATAGTTCAGATTACGGTGTAGGTGCAGTTTTGTCACATGTCATGAGTGACCGACAGGAACGACCTGTTGCTATGGGGTCCAGGACACTTCACATGCACGAACGGCGCTATTCGCAGCTAGATAAAGAAGCGACTGCAATAATGTTTGGAATAAATAAATTTCAGAACTATCTCATGGGACGGTCATTTACTATTGTCACGGATCACAAACCTTTGTTAGGTATATTTGATCCAAGAAAGCCCATTCCTAATATGTTGTCACCACGTCTTACAAGAATAGCATTAGTACTTACTTCACATAATTATGATATTATTTATAAACCGGGAAAATGCATAGGACATGCAGATGGGTTGAGTCGTTGGCCACAACCTGTATCAGAACAACCTGAAGAACAGCTTCAGGACATATTGCTACTGGCCGAAACACCAGACGAGTTTCCAATAGATGTTGCTCAAATAGCAAATGCTACCAAACGAGACTCAGTTTTGTCTCGAGTACGGCATCATATACTTTCCGGATGGCCAGCTAAGATAAATGATGAGTCGCTACGTCCATACTGGCTTCACCGAAATGAATTTTCCTTGAATGAAGACTGCATTCTAATAGGCAATCGTGTAATAATACCACCATCGTTTCGGCAGCCAGTTTTAGATTGTTTGCATAAAACTCATAGTGGCATCGTTCAAACTAAAGCGATTGCTCGTAGCTACGTCTGGTGGCCACAAATGAATAAGGATATTGAAAAGTTGGTAAAGAACTGTAATCGCTGTTTGGAAAATCGACATATGCCCCCTAGAACAACTTATGAATGGATAACTCCTACCAAACCTTGGTCTCGTATTAATGTAGATTTTGCGGGACCATTCCAAAATAAAATATTCCTGATTATAGTTGACGCGTATTCGCGATGGCCAGAAGTATTCATTGTTAACAATATGACTTCGTCGACCGTTGTTAAACACCTTCGAACAATATTTGCGACACACGGATTGTGTGAGGTATTGGTGTCTGACAATGGAACACCTTTTGTATCTGAAGAAACGAGAAAATTTCTAGAGTCTAACAAAATTAGACATATTACAACGGCGCCACATCATCCGTCTACTAACGGACTGGCAGAAAGAATGGTTCAAACAGTCAAGGACAAGTTACGGAAGATGGACGGTATCTCTTGGGATATAAAACTTCCCAATATATTATTAGGACTTCGCACAATTCCATGTGCAACAACAAATAAAAGTCCATGTGAATTATTGATGAACAGGCGTTTGCGCACCTTGCTTGATACACTCCATCCAGACAATCTCCAAACGTGTAAGAGAAATGAACAGATTGAAAGAAATGGCAACAAAAAAATTAGACACACTGATGTGGGGCAGAAAGTGATGTACAGGAACTTTGGAAATGGATCCCGTTGGTTACCAGGAACGGTAGTTTACAGGAATGGGCCAGGAAACTATCAAGTAGAAACTGGTGATGGAACTGTGGTGAATAGACATATAGATCAATTACTTAAAAAAGAAACAGATTCTGGACAGGAAACTGCAGAAAGAGGGAAGGAATCGGAATTGGATTGTGAGGCAGTGAATGTTGAGGAACAAGAAGATATGGAAGACATTTCTAGTAGTTTGGAGGAACAGGAAATTATAGAGATACCGAGTCCGGATAAATGGGCAGAAATGTTAGGAATTCCTCCCGAACCAGAATCAGGATATTCTGGTGGTAAAATTCGTCACAAAAGTCACATACATCAGAGGTCACCTTATAGTAGATTTAACTATAATTACATTAATTAA
Protein
MLRDRLVCGMSDHKLQYELLKREQLRYEDVVHAMVSSESAGKDVRMIQSTSTDTFGMTQGEVVTSHAEPMEVNVVNFKRNFRLCYRCGDRHGGECRYINSICHYCKKKGHIEKICTSKKNNKRKSINYTDDEFQAQLNGIYNVNTNSRRVPAYEVKVLLDGVPVIMEVDSGAAYSLVNLHTWRRIHSHMPLEPLMNKLCTWNNSAVRVDGQATVLVQYKDIKCSLKVIVAQGSGPNLLGRNWFEALGICVNVNTIKEINVTEVILNKHYEVFRAGLGTYRGEPVNIHLKPGAVPRFMKARPVPYAIKERVEKEINRLEAEGVLRPVTFSEWATPVVPIVKKNGDVRLCGDYRSTVNQATESDTYPMPTASEVFATISGGNIFSTLDLDRAYTQVVVTDDTARLLTLNTCKGLYTVHRLAFGVKASPGIFQRLMTALLAGISGVAVLIDDIIVSGRTAQEMTQRLDAVLDRIEKAGLRLNKGKCKFARKQVEFLGFIIDAEGIHPAPSKIESILKTPKPKNVQELQAFLGLYNFYERFIPHKATILEPLHRLLDKAHKWQWSEREQKSFEVAKRLLSSELTLAHYDLEKPLILTCDSSDYGVGAVLSHVMSDRQERPVAMGSRTLHMHERRYSQLDKEATAIMFGINKFQNYLMGRSFTIVTDHKPLLGIFDPRKPIPNMLSPRLTRIALVLTSHNYDIIYKPGKCIGHADGLSRWPQPVSEQPEEQLQDILLLAETPDEFPIDVAQIANATKRDSVLSRVRHHILSGWPAKINDESLRPYWLHRNEFSLNEDCILIGNRVIIPPSFRQPVLDCLHKTHSGIVQTKAIARSYVWWPQMNKDIEKLVKNCNRCLENRHMPPRTTYEWITPTKPWSRINVDFAGPFQNKIFLIIVDAYSRWPEVFIVNNMTSSTVVKHLRTIFATHGLCEVLVSDNGTPFVSEETRKFLESNKIRHITTAPHHPSTNGLAERMVQTVKDKLRKMDGISWDIKLPNILLGLRTIPCATTNKSPCELLMNRRLRTLLDTLHPDNLQTCKRNEQIERNGNKKIRHTDVGQKVMYRNFGNGSRWLPGTVVYRNGPGNYQVETGDGTVVNRHIDQLLKKETDSGQETAERGKESELDCEAVNVEEQEDMEDISSSLEEQEIIEIPSPDKWAEMLGIPPEPESGYSGGKIRHKSHIHQRSPYSRFNYNYIN

Summary

EMBL
GGLE01005288    MBY09414.1    JYDP01000327    KRZ01162.1    JYDL01000080    KRX17894.1    + More
JYDO01000093    KRZ71620.1    JYDH01000010    KRY40903.1    JYDO01000377    KRZ65389.1    JYDN01000036    KRX62850.1    JYDN01000181    KRX54093.1    JYDW01000348    KRZ48953.1    KL363314    KFD47775.1    HADW01008367    SBP09767.1    HADX01010638    SBP32870.1    JYDJ01000011    KRX49884.1    JYDJ01000764    KRX33566.1    KL363295    KFD48373.1    KL363264    KFD49780.1    KL367504    KFD68531.1    KL363391    KFD46136.1    GEZM01036245    JAV82862.1    KL363215    KFD53596.1    KL363640    KFD45214.1    KL363340    KFD47113.1    KL367859    KFD59517.1    JYDJ01000151    KRX42156.1    GEZM01002003    JAV97411.1    GEGO01004533    JAR90871.1    JYDW01000004    KRZ62956.1    GEGO01004367    JAR91037.1    KL363326    KFD47456.1    KL363234    KFD51889.1    KL363194    KFD56378.1    KL367538    KFD65454.1    KL367519    KFD67037.1    KL367520    KFD66862.1    EF199622    ABM90393.1    JYDI01000102    KRY52595.1    KL363282    KFD48880.1    KL367649    KFD60777.1    KL363192    KFD56650.1    GEFM01006397    JAP69399.1    GEGO01004800    JAR90604.1    KL363212    KFD53932.1    EF199621    ABM90392.1    KL367587    KFD62819.1    KL367660    KFD60582.1    JYDH01000458    KRY26369.1    HAAD01006009    CDG72241.1    JYDL01000185    KRX13745.1    NIVC01001377    PAA68677.1    NIVC01000183    PAA88548.1    JYDO01000016    KRZ77842.1    NIVC01001575    PAA66240.1    GFAA01002959    JAU00476.1    GEDV01006828    JAP81729.1    GCES01009650    JAR76673.1    LBMM01009301    KMQ88234.1    NIRI01001153    RJW67559.1    GEZM01074359    JAV64586.1    KRX62859.1    GEGO01004421    JAR90983.1    GFWV01017841    MAA42569.1    GEZM01085032    JAV60302.1    GBIH01000761    JAC93949.1    GEGO01004331    JAR91073.1    GEGO01004729    JAR90675.1    KL363205    KFD54672.1    KRX54086.1    GEFM01006393    JAP69403.1    GCES01042893    JAR43430.1    JYDQ01000025    KRY20467.1    GCES01151725    JAQ34597.1    HAEH01013823    SBR98409.1    GEGO01004748    JAR90656.1    NIVC01001652    PAA65446.1   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF00077   RVP
PF00098   zf-CCHC
PF17917   RT_RNaseH
PF07727   RVT_2
PF13976   gag_pre-integrs
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR018061   Retropepsins       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
IPR001995   Peptidase_A2_cat       
IPR009068   S15_NS1_RNA-bd       
IPR013103   RVT_2       
IPR025724   GAG-pre-integrase_dom       
IPR034128   K02A2.6-like       
IPR008936   Rho_GTPase_activation_prot       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF47060   SSF47060       
SSF48350   SSF48350       
Gene 3D
PDB
4OL8     E-value=5.14564e-54,     Score=538

Ontologies

Topology

Length:
1192
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0487000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00160
outside
1  -  1192
 
 

Population Genetic Test Statistics

Pi
374.645988
Theta
221.637517
Tajima's D
2.079585
CLR
10.833305
CSRT
0.892405379731013
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号