SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05540
Pre Gene Modal
BGIBMGA005783
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.422
 

Sequence

CDS
ATGCAGTTAAGTCTTGGAGATGAAAACGTGGAAGTGGAAACTTCTCCAGGCCCATCTGGAATTCCACAACGGCCTTCATTGACAGAGCAATTGAAAGTCGCCAAGGTGGCGAGGCTTTTGGATAAAAAGCATGAGAATTTGCTGTCTGCGGACCAAAAAAAGGAGCTGGCCAGGCTGCGCGATGGCAAGCAAGTGGGCAATTTTAAAATGCCAGATGCTCCAGAACCACAAAGAGGAAGAGGAAAGGGAAAGGGGAAGGGCAAAGGAAGGGGCAGTGAAGACTCGCGGATGTGGAGGCCATGCCCACTTTTACCTGGGGTACCAACTGTCCCTCCTCCACGTGTACGTCAGTCGTGGGAATTGCAACAGCAACGCCCGATTGATATCACCGCGGAGCAGGAGGGTGAGGATGATGACATCGAAAGCTATTTTCTTCCAGATATCACCGAGGATGAGGAGATGCGTCCTCCCCTCCTCGAGGATGAGGAGGCCGTTCCTTCTGCAGGGACCCCACCTCAAGCGAAGAAACGCAAGATCCAATTTTCGCCCTCGATGGGGATCATCCAGGCTACTGCATTGCCTCAAAATATCGTGCCAGCAGAGATAGAACTCCTGGGGTTTACACCTTATATCGATATAAATATGGAGCGTGACTTCATAGAGCCTGGCGAAGGCAGCGAAGTAGATGAAGGTGATTCGGCGAATATGGTCGGTATGATCGATATTTCTTTGAAACCAAGACGAATCGATGATTTTCCGATGGACTTAGACAGTATTGCTGAACATGAGGTAGTTGAGGTGATACAGGAGCTGGACAATGCTGCCGACGAAGTCCTTCGGAACGTGGTAGGACCGGAAACCGATCTGCTTCATTTTGACTGGCGAGGCGAGCCGGAAAATTTTGAGTCTGTCAGGGAAGCATTTACTGTGCCATCTACTGGACCAACGTTTGATAACGCCGATTTAATTCCCTTAGATGTTTTTTTCAAGATTTGGGATGCAGATATTATTGCTTACATCGTGCGCGAAACCAACCGCTACGGTGCTGAGCTAATAAGGTCGACCATTCCATCCAAGCCAAATTCTAGATTAAGCCGTTGGAAAGACGTCACCAGTGACGAAATCCTACGGTTTTTAGCAGTTTTAATGTTACAGTCACTAGTTATAGATTATGTGGAGCGCGAATATTGGTATGCCGTGATTGAAGAACTCCAAATAGGCAATTTTAAAGAAATAATGACTTATAACCGTTTCATCGTCATCAAACGTTGTCTCCATTTTATAGACAATGCCACTTTGCCCGTGCCGCCTACCAAACTCGATAAAATCATCCCCATCATAGAGCACCTAAACAAAAAATTTAAGTCTTTATACGTACTAGAACAAAATATAGCAATTGACGAGTCACTCCTTCTTTGGAAGGGGCGCCTCTCATTTGCGCAAAAAATTGCTACAAAAAGAGCTCGAGTAGGTATAAAGTCTTACGAGTTATGTGAATCCAGGACTGGATATTTATGGCAGATGGAGGTCTACACGGGCAAAGGGCACGCACATGTGGTACAAGACGGGGAGCCGGAAGAGCGCGGGCAAGAGTCTGACGAGCCGGAGAGTGCCACGGCCCAGATTGTGCTGAACTTAACGAGATCACTTTTTGATAAAGGCCATACATTAATAATGGACAATTTTTATAATGCGCCACTTTTGTCTCGGATCCTAAAAGTTCAGCACAAGACTGATTCGATGGGTACTCTACGACTTAACAGAGAGTTTGTCCCCGAAGCTCTTAAAAAAAAAACAAAAAAAAACATGAAGGAGGGCGAGGTGGCATTCAGCACAACCAAAGACCTCAGTGTGGTTGTGTGGATGGACAAAAATATTGTGGCAATGATTTCTTCTTTCCATCCCATAGAAGTCGGCGGCATTGAAAAATACGGTTATTACCGGTACAAACCGCAAGTTGTTCTTGATTATAATTTCTCAATGGGCGGCATCGACCACAAAGATCAAATGCTGTCTGCCTATCCCATTGAGAGATCACGTAACATAATCTGGTACAAAAAATTATTTCGCCGACTTTTAAATGTATCGATGCATAATGCTCTCGTGATGTTCAACCACAACCGCACTCACGCCCTTCGTCACCGTGAATTCCGCCTGCAGTTGGCAAAGCAACTGCTGCAAAGCAGCAGATCAGCAGCACCTTCCCGGTCTTTAGCACCGGCAGCACGACCAGAACCAGCGGCATGCATACGGGACATGCACTTGCCAGGAAAAAATACAAAAAAACAGCGCTGCAAGCTCTGCTACTCTGCCAAAGTGCAGCGCTCGACGGTGTGGCGGTGTACCACCTGCAATGTCAATCTGTGTATCGTAGGATGCTACACCGTATACCATATCAATCTAGCGCAAACGCCCGCCGTTTAG
Protein
MQLSLGDENVEVETSPGPSGIPQRPSLTEQLKVAKVARLLDKKHENLLSADQKKELARLRDGKQVGNFKMPDAPEPQRGRGKGKGKGKGRGSEDSRMWRPCPLLPGVPTVPPPRVRQSWELQQQRPIDITAEQEGEDDDIESYFLPDITEDEEMRPPLLEDEEAVPSAGTPPQAKKRKIQFSPSMGIIQATALPQNIVPAEIELLGFTPYIDINMERDFIEPGEGSEVDEGDSANMVGMIDISLKPRRIDDFPMDLDSIAEHEVVEVIQELDNAADEVLRNVVGPETDLLHFDWRGEPENFESVREAFTVPSTGPTFDNADLIPLDVFFKIWDADIIAYIVRETNRYGAELIRSTIPSKPNSRLSRWKDVTSDEILRFLAVLMLQSLVIDYVEREYWYAVIEELQIGNFKEIMTYNRFIVIKRCLHFIDNATLPVPPTKLDKIIPIIEHLNKKFKSLYVLEQNIAIDESLLLWKGRLSFAQKIATKRARVGIKSYELCESRTGYLWQMEVYTGKGHAHVVQDGEPEERGQESDEPESATAQIVLNLTRSLFDKGHTLIMDNFYNAPLLSRILKVQHKTDSMGTLRLNREFVPEALKKKTKKNMKEGEVAFSTTKDLSVVVWMDKNIVAMISSFHPIEVGGIEKYGYYRYKPQVVLDYNFSMGGIDHKDQMLSAYPIERSRNIIWYKKLFRRLLNVSMHNALVMFNHNRTHALRHREFRLQLAKQLLQSSRSAAPSRSLAPAARPEPAACIRDMHLPGKNTKKQRCKLCYSAKVQRSTVWRCTTCNVNLCIVGCYTVYHINLAQTPAV

Summary

Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
Interpro
IPR018159   Spectrin/alpha-actinin        + More
IPR029526   PGBD       
IPR032718   PGBD4_C_Znf-ribbon       

Ontologies

GO

Topology

Length:
807
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10596
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00010
outside
1  -  807
 
 

Population Genetic Test Statistics

Pi
51.639708
Theta
3.159593
Tajima's D
0.130485
CLR
0.621772
CSRT
0.434878256087196
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号