SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05508  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006617
Annotation
PREDICTED:_zinc_finger_CCHC_domain-containing_protein_8_homolog_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.968
 

Sequence

CDS
ATGGACGATGACGACGGGGGTGAGGGCTTCAGCTCCGCCCCTGTGTCCGCTCCCAAAATAATGGGAAAACGAAGATTGACCTCATCTGAATACGACGAAAGCCGCAAAATAAAAATGACTTTCATTAAAAATAAGCGCGGTCTTTTTAAAGACCACCATGCTCTATATGAAGACCTTACAAAAAAAGAATATCCAGTGCTTCTTCAGTCAAGCCTCTCGCAACCAAATAACAGAGTCCCAATGGACCTGTTAAGAATAAACAAAACTTTAAAAAATGTTGAAGGGGTACAGTATGTCAAAGCTGCTGGAAACTTTTTTGCTAAAGTTTACTTTGGCTGTGCTCGGGATGCCAACGCTTTTTTATTAGATGTAAGCTTTATGGAGTTAAACAATTGGACAGCAAAAATACCTTACGATAGCATTGAGAGTCAAGGAATTATTCGAGCTCCTGTGGAATTAGATGAAGAATCTCTTTTAGTAAATTTAAAAGCTACATGCACAATACTCGGAGTAAAAAGATTTTTCAAAAAACAAGAAAATGGAAGTGACAAGCCACTGCAAACTGTGCTGGTTACATTTTTGGCGTCTAGCCATCCTGATCATGTCACATACGAGCATATTTGGATGCCTGTTTCGGATTATATTAGACCTGTGTTACAGTGCTTCAAATGCTACAAATTTGGACATGGAAGTGGTGCCTGTAAAGCCACTCAAGTTTGCTCTATTTGTTCAGGCAATCATTTTTATAGGGAGTGCAGCACTCCCAACATCTTCAAGTGCTCCAACTGCAGTGGGCCACATTCTGCAGTTTCTTACTCTTGCTCAGTAAAGGCAGCCAAGGTTGCTGAAGTAAAAAATAAGATTATCGGCAAGCAAACATCATACGCAGCCATACTAAAGAATCCTGTAATTAAGAACCCCGTGACCTCTTCTGGCATACCTATATCTGCGAAGACCCCTCAAGATTTTGATCTTTCGTGGAAAACTCATATTGATGTTATTTGTAAAAGAGCTGAATTAGGTTTGAATATATTAAAATCGCTAACTGGAGTAAAATGGGGAGCTGATCCCAAAGTTTTAAAAACTATTTACATTGCAACAATCCGAAGCCATTTCGATTATGGCAGTCACTCTGGTATTGTGGGTAATGAATTTGTTGATAAATTAGCCAAATCTACAAAAGATATAAATATTTCCGATTTTAAAGTTCCGTACTCAGATTTAGTTTATTCAATTAAACAAAATATGATGAAACGTTGGAAGACTGGTGTCAAAGATATCATTTATGAATTAGACAATGAGGATCTCGAACTCAGCAGTGAAGATGACGTTTTGGAGACAAAAATAAGGCGTTTAGATACTGATGTAGTGCCTTATTCCGCTGAAAGCGATTGTGTTATCCAGGAAACACCTGTAGACGTTATAAATATTGACAGTTCGTGCGAGGATGCTGGAGAAAACAATGCTGATGAAAAAGAGGGAAATGGAGGGAAAATAACGAATCAACCCTTGAGATCTAATGACAACTCTAGTGAACTATATACAATATGTGTAGATGAAGACTTAGGTACTGAAGAAAGCACTAAAATTTTTAATGATGATATTTCTGTAGACACTCCTACATCGAATAGCGACGGTAGTGTAGTAGGCTGTGTAAACAGGACACCTCTTGTGAGCGTTCAGTTTAGAGACAAAAAACTGGCTAGTAGCTACAAGCAAAAAGTAAAAGCGTTTATGCTGAAACTTATAAAGATTCATAATGACGATGCATTAGAAGGTTCAGAATGTGAGACAGACTTAGAACTTGACATTTGGCCAGAAGATGTTGTTGAGGAACTTCCTAAACAAGAGGAAGTGAAGACTGTAGATGATAGTCTCTTCTTTGTTGATACAGATCCAAGTGTGAATTGTGCTATTGAAGAAATACCTAGATACAGTGAGGGATCAAACTTAATATCAGATAATGTGGAAACAGAGTTGCCATTGAATTCAGTCCGCCCGTTAAAACGAGGTCCAATTTGTTTTAATTGTGATGGTAGCCATGCTTTGAGAGAATGCAAACAGCCTAGAGATGCAATTCGAATAGCCGAACAACGGCGTAATTTCACGAAGGTTGGCCGTTACCATGTGGAAGATGAACAAAAGTATGGGCACTTGGTGCCTGGCCGTATTTCTGGACAACTTCGACACGCATTAGGTTTGAAGAGACACGAATTACCAATGCATATTTATCGCATGAGGGTGTTGGGGTATCCGCCAGGATGGCTAGAGGAAGCTCGGATATCACATTCTGGAATAACAATGTTTGATTCTTCTGGTAATCCAATAACAGAACTTGACGAGGAAGATGGTGAAGTATGCGAGCCTGGTTCTAAAGACAAGTTTGATATTAAAAAGATCTACGACTTCCCTGGTTTCAATGTTCCCGCCAGTTCTAGATACAAAGAGGAAGGCGAACAATTCGGCTTCCCATCCTTGTCCTTACAGGACAGTAAAATAGCAATGCTGCAAAATTTGGCTCCAAATGCGATGAAGGCTTACAAACGGAAGAAACTTACTTTCTTTCCCTCATCAAATTTGGAAAAACCTGAAGGCGAAGCTGAAATGGAACTCGACAGCGGAGATGAGGAGATAGCGTTTCCGACTGTCCCTCCGTTACCAGACGAGATGCCTCCTCCTCCTCCCCCTCTACCGCCTTCCCCGCCGCCACCTCCGCCGCCACATACACAAACAGATATGGAGGAAAAAATAAAAACATTGAATGAAACACAGAACGTATCAATTAGTGACCCCGTAACAGCTACAGATGAAATAGAAATATCGAATACTTCTAATGGCCGCTATAGTCCGAGTATCGAAGATCTAGAAGCAAAGAAGAAGTTATTATTAGAGGTCATTGAAAATGAAAATGAAGTTGCAAATGAGGAAGCTGCACAAGACGTAGAAATTCAGAATGAAAGTAATAATGGAATCGACGCAGAAAATAAGGAGAAAGAAGTCATCGCTGTTGAAAATGTAACATCTAACAATGATGCCGGGAGAGTTCCAACACCGAACTCAGTATTAAGCGATGAGAAATCATCATTGACACCGCGACCGGCTAGAGAGGTCGTCGAGAAAGAGCAAGCGCGTTCAGAGGACAACAGAGATCAAATCCTCACTCCCAAACGCGACACAACTTGTAGCAGTAATGACGAAACGCCGACTACTACAGCTGGTAGTGACACCGATGTATTGAAAACACCAGACGCACAGCAAACAGGTCGAGTGAAGACCACGGACTACGGCACTCCGGTCCTCAACATCGCGTCTCCTTACCGCAAGCTACCGAGCGGGACCAAATTCGCCAAAGACATCTGTGACGTTTTATATTTCGAAAACCTGCCAAATTCGACGGGAAATTATAAAAAAATGACCACCCTGCTCAAGAAAGTTAAAGACGAAGTTGACAGGATACAAGATTCATGA
Protein
MDDDDGGEGFSSAPVSAPKIMGKRRLTSSEYDESRKIKMTFIKNKRGLFKDHHALYEDLTKKEYPVLLQSSLSQPNNRVPMDLLRINKTLKNVEGVQYVKAAGNFFAKVYFGCARDANAFLLDVSFMELNNWTAKIPYDSIESQGIIRAPVELDEESLLVNLKATCTILGVKRFFKKQENGSDKPLQTVLVTFLASSHPDHVTYEHIWMPVSDYIRPVLQCFKCYKFGHGSGACKATQVCSICSGNHFYRECSTPNIFKCSNCSGPHSAVSYSCSVKAAKVAEVKNKIIGKQTSYAAILKNPVIKNPVTSSGIPISAKTPQDFDLSWKTHIDVICKRAELGLNILKSLTGVKWGADPKVLKTIYIATIRSHFDYGSHSGIVGNEFVDKLAKSTKDINISDFKVPYSDLVYSIKQNMMKRWKTGVKDIIYELDNEDLELSSEDDVLETKIRRLDTDVVPYSAESDCVIQETPVDVINIDSSCEDAGENNADEKEGNGGKITNQPLRSNDNSSELYTICVDEDLGTEESTKIFNDDISVDTPTSNSDGSVVGCVNRTPLVSVQFRDKKLASSYKQKVKAFMLKLIKIHNDDALEGSECETDLELDIWPEDVVEELPKQEEVKTVDDSLFFVDTDPSVNCAIEEIPRYSEGSNLISDNVETELPLNSVRPLKRGPICFNCDGSHALRECKQPRDAIRIAEQRRNFTKVGRYHVEDEQKYGHLVPGRISGQLRHALGLKRHELPMHIYRMRVLGYPPGWLEEARISHSGITMFDSSGNPITELDEEDGEVCEPGSKDKFDIKKIYDFPGFNVPASSRYKEEGEQFGFPSLSLQDSKIAMLQNLAPNAMKAYKRKKLTFFPSSNLEKPEGEAEMELDSGDEEIAFPTVPPLPDEMPPPPPPLPPSPPPPPPPHTQTDMEEKIKTLNETQNVSISDPVTATDEIEISNTSNGRYSPSIEDLEAKKKLLLEVIENENEVANEEAAQDVEIQNESNNGIDAENKEKEVIAVENVTSNNDAGRVPTPNSVLSDEKSSLTPRPAREVVEKEQARSEDNRDQILTPKRDTTCSSNDETPTTTAGSDTDVLKTPDAQQTGRVKTTDYGTPVLNIASPYRKLPSGTKFAKDICDVLYFENLPNSTGNYKKMTTLLKKVKDEVDRIQDS

Summary

Uniprot
ProteinModelPortal
PDB
5LXY     E-value=6.15475e-06,     Score=124

Ontologies

GO

Topology

Length:
1155
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00125
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00006
outside
1  -  1155
 
 

Population Genetic Test Statistics

Pi
211.025397
Theta
189.624165
Tajima's D
0.502042
CLR
0.0021
CSRT
0.512924353782311
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号