SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05506
Pre Gene Modal
BGIBMGA006619
Annotation
dopamine_transporter_[Bombyx_mori]
Full name
Transporter       + More
Sodium-dependent dopamine transporter      
Alternative Name
Protein fumin
Location in the cell
PlasmaMembrane   Reliability : 4.883
 

Sequence

CDS
ATGGCGCTGAAGACCCCGACGCCGGGTGTTGTCGGCGAACGCGAGACCTGGGGCAAGAAGGTCGACTTCCTGCTCTCGGTCATCGGGTTCGCCGTCGACCTCGCCAACGTGTGGCGCTTCCCCTACCTCTGCTATAAGAATGGAGGGGGTGCGTTTTTGGTGCCATACTGCATCATGCTGGTAGTGGGTGGAATTCCACTTTTCTACATGGAGTTGGCGCTGGGACAATTTCACAGGAAGGGTGCCATCACCTGCTGGGGCAGGCTTGTCCCGCTTTTCAAAGGAATCGGTTATGCTGTCGTCCTGATCGCGTTCTACGTGGACTTTTACTACAACGTGATAATCGCTTGGGCGCTGCGTTTTTTCTTCGCCTCTTTCACGACCATGCTACCTTGGACCAACTGCGACAACGAATGGAACACACCTGCCTGCCGACCGTTCGAAGCCATTTGGGACGTTAACCGTACACGTATACGCAATACCACGTCCGCAAGTTTGGGAATCGCTCCGACAACACCGTACACTTCTGCTGCTTCGGAATATTTCAACCGCGCGATTTTAGAATTGCAAGGCAGCGAGGGGCTCCACGACCTTGGTTCTGTAAAATGGGATATGGCGCTGTGTTTATTGGCCGTCTACGTCATCTGCTACTTCTCCTTGTGGAAGGGAATCAGTACTTCTGGAAAAGTTGTTTGGTTCACAGCACTCTTTCCGTACGCTGTTCTTTTGATACTCTTGGTTCGTGGTATCACCCTCCCTGGATCGGCGACCGGAATCCAATACTATCTGAGTCCGAACTTTGAAGCTATAACTCAACCTCAGGTGTGGGTGGACGCCGCTACTCAAGTCTTCTTTTCTCTTGGACCGGGCTTTGGAGTGCTCTTGGCTTATGCATCGTACAACAAGTACCACAACAACGTGTACAAGGACGCCATTTTGACCAGCGTCATAAATTCCGCAACGTCTTTCGTCGCTGGTTTCGTGATCTTCAGCGTGCTCGGCTACATGGCGCACGCTTCGGGCAGAGACGTTCAGGATGTCGCAACCGAAGGCCCGGGACTAGTTTTCGTGGTGTACCCGGCGGCTATAGCTACGATGCCAGGATCAACGTTTTGGGCGCTTATATTCTTCATGATGCTGCTTACACTTGGGCTTGATAGTTCTTTTGGGGGTTCCGAAGCGATAATCACAGCTCTCAGTGACGAGTTCCCTCCTATCGGACGTCATCGCGAATTGTTCGTCGCCTGCCTCTTTACGTTGTATTTCTTCGTGGGACTGGCCTCTTGCACGAAAGGCGGATTTTACTTCTTCCAGCTCTTGGATCGCTATGCTGCGGGCTATTCTATTCTCATCGCTGTTTTCTTTGAGGCCATAGCTGTCTCCTGGATTTATGGCACGGAAAGATTTTGTGAGGACATTCGCGACATGATCGGCTTCAGACCTGGCCTGTACTGGCGCGTTTGTTGGCGTTTCGCGGCACCATCTTTTTTGCTCTTCATCACGGCATACGGACTCTTAGACTACGAACCTCTGCAATACGAGAACTACATCTATCCAGGCTGGGCCAACGCACTTGGCTGGGCCATTGCTGGATCCAGCGTCATGTGCATACCGACAGTGGCTATCTATAAACTGATTACAACTAAAGGATCGTTTTTGGAGCGTCTTCGCGTTTTAACAACCCCTTATGCAGACAGCGAACGTAATGGAACCGTGCACAACGGTATGATAGTGTCCGAGAGCGGCGGCGTTCGGCTGACGTCAGCGGTGCAAACCCCCACAACTCCACAGCAACCGATCGGAGCAAATATTCCAGCAGCCTCGGCTCCAACTCTCGCTTCATCTCCAGCGCTGGTCTGA
Protein
MALKTPTPGVVGERETWGKKVDFLLSVIGFAVDLANVWRFPYLCYKNGGGAFLVPYCIMLVVGGIPLFYMELALGQFHRKGAITCWGRLVPLFKGIGYAVVLIAFYVDFYYNVIIAWALRFFFASFTTMLPWTNCDNEWNTPACRPFEAIWDVNRTRIRNTTSASLGIAPTTPYTSAASEYFNRAILELQGSEGLHDLGSVKWDMALCLLAVYVICYFSLWKGISTSGKVVWFTALFPYAVLLILLVRGITLPGSATGIQYYLSPNFEAITQPQVWVDAATQVFFSLGPGFGVLLAYASYNKYHNNVYKDAILTSVINSATSFVAGFVIFSVLGYMAHASGRDVQDVATEGPGLVFVVYPAAIATMPGSTFWALIFFMMLLTLGLDSSFGGSEAIITALSDEFPPIGRHRELFVACLFTLYFFVGLASCTKGGFYFFQLLDRYAAGYSILIAVFFEAIAVSWIYGTERFCEDIRDMIGFRPGLYWRVCWRFAAPSFLLFITAYGLLDYEPLQYENYIYPGWANALGWAIAGSSVMCIPTVAIYKLITTKGSFLERLRVLTTPYADSERNGTVHNGMIVSESGGVRLTSAVQTPTTPQQPIGANIPAASAPTLASSPALV

Summary

Description
Sodium-dependent dopamine transporter which terminates the action of dopamine by its high affinity sodium-dependent reuptake into presynaptic terminals (PubMed:11125028, PubMed:12606774, PubMed:24037379, PubMed:25970245). Also transports tyramine and norepinephrine, shows less efficient transport of octopamine and does not transport serotonin (PubMed:11125028, PubMed:12606774). Plays a role in the regulation of the rest/activity cycle (PubMed:16093388, PubMed:25232310).
Miscellaneous
10-fold less sensitive to cocaine than mammalian dopamine transporter SLC6A3.
Similarity
Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family.
Keywords
3D-structure   Cell membrane   Complete proteome   Disulfide bond   Glycoprotein   Membrane   Metal-binding   Neurotransmitter transport   Reference proteome   Sodium   Symport   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Transporter
EMBL
DQ105979    AAZ17653.1    NWSH01004992    PCG64517.1    AY154398    AAN52844.2    + More
BABH01008498    BABH01008499    BABH01008500    ODYU01009490    SOQ53966.1    AGBW02011059    OWR47287.1    DQ105980    AAZ17654.1    KQ459984    KPJ19036.1    KP657644    AKL78869.1    RSAL01000201    RVE44440.1    KQ458793    KPJ05063.1    JTDY01000624    KOB76428.1    CH477638    EAT37969.1    GECL01000819    JAP05305.1    GBBI01002316    JAC16396.1    AB720744    BAM15639.1    GBGD01000916    JAC87973.1    GFTR01007359    JAW09067.1    NEVH01002992    PNF41019.1    JRES01001695    KNC20917.1    KQ981280    KYN43463.1    GL435030    EFN74191.1    ATLV01024553    KE525352    KFB51612.1    AXCN02000388    AXCN02000389    KQ976885    KYN07475.1    CH933808    EDW09490.2    ADTU01023469    ADTU01023470    ADTU01023471    KQ982911    KYQ49330.1    AAAB01008807    EAA04277.4    GL888066    EGI68379.1    KQ976511    KYM82529.1    KQ980824    KYN12561.1    GAMC01008426    JAB98129.1    CM000158    EDW91906.1    GAMC01008425    JAB98130.1    CH954179    EDV55741.1    CH940648    EDW62047.2    CH480816    EDW48158.1    CH916367    EDW01094.1    CM000362    CM002911    EDX07375.1    KMY94287.1    AE013599    AGB93558.1    AF260833    AF439752    AY051579    AAF76882.1    AAK93003.1    AAL32055.1    CCAG010001148    KQ434782    KZC04540.1    KK107154    EZA56881.1    QOIP01000001    RLU27541.1    GEBQ01006674    JAT33303.1    KZ288254    PBC30725.1    OUUW01000001    SPP73459.1    KQ435763    KOX75413.1    CH963849    EDW74016.1    GDHF01011983    JAI40331.1    AB370000    BAH22564.1    GDHF01029321    JAI22993.1    CM000071    EAL25019.2    CH479181    EDW31845.1    UFQS01001621    UFQT01001621    SSX11636.1    SSX31201.1    CP012524    ALC41674.1    CVRI01000043    CRK96201.1    GBXI01008487    JAD05805.1    GFXV01002857    MBW14662.1    GGMR01019255    MBY31874.1    GL732616    EFX70864.1    DS232104    EDS34926.1    ACPB03008045    GDIQ01216288    JAK35437.1    GDIP01007470    JAM96245.1    GL762910    EFZ20467.1    LNIX01000006    OXA52564.1    AXCM01001523    JXJN01007860    KQ761824    OAD56761.1    GDIQ01164868    JAK86857.1    APCN01000197    GDIQ01101821    JAL49905.1    ADMH02001280    ETN63223.1    KK113777    KFM61014.1    CH920905    EDW04524.1    KA649196    AFP63825.1    GDIP01159633    JAJ63769.1    LRGB01002836    KZS06180.1    GECU01031913    JAS75793.1    GGLE01005702    MBY09828.1   
Pfam
PF00209   SNF
Interpro
IPR037272   SNS_sf        + More
IPR000175   Na/ntran_symport       
SUPFAM
SSF161070   SSF161070       
PDB
4XPA     E-value=0,     Score=2216

Ontologies

Topology

Subcellular location
Cell membrane  
Length:
619
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
266.25967
Exp number, first 60 AAs:
26.62077
Total prob of N-in:
0.71042
POSSIBLE N-term signal
sequence
inside
1  -  22
TMhelix
23  -  42
outside
43  -  51
TMhelix
52  -  74
inside
75  -  94
TMhelix
95  -  117
outside
118  -  202
TMhelix
203  -  225
inside
226  -  229
TMhelix
230  -  252
outside
253  -  278
TMhelix
279  -  301
inside
302  -  312
TMhelix
313  -  335
outside
336  -  354
TMhelix
355  -  377
inside
378  -  411
TMhelix
412  -  434
outside
435  -  443
TMhelix
444  -  466
inside
467  -  486
TMhelix
487  -  506
outside
507  -  520
TMhelix
521  -  543
inside
544  -  619
 
 

Population Genetic Test Statistics

Pi
203.655259
Theta
171.773883
Tajima's D
0.897598
CLR
0.350999
CSRT
0.630468476576171
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号