SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05502
Pre Gene Modal
BGIBMGA010315
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106708942_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.732
 

Sequence

CDS
ATGGCTAACTATGAGAGAGATTTGTCATACGACCCGGCTGACGCCCGGCGCTCGCAGGTACCCGGGCCTGCGAGTGATAAATTGGTTACCGATGGACGCGCAGGAGTAGGCGACCAGGCCCCTGTTGCTGATAATATTACTGGAAGCAGTTATTTTGAAAATATTGACGGAGGACCGCGTGGGTCGTCTTCCGTTAGAAAACGCTCACGCGACAATGCTCCAGTGGGAGATGGGTCGGTAGATCTGTCCTCAGATGAGGAAGGCTTGCTGCCCCCCAAGAAATTACCGACCACGAGGAGAGGTCGGCAGGCTTCGAGAGGAGTGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTCCAATACTCCGGCTGCCAGCAAAGCAGATAGTGACATGGGGGTCACTACCGAGGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCCGAAGAGAGCAGCGCAAAGCTGTCGCGGCCGACGAAGTGTCGGAAATGGCCCGACGCGCACGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTGAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGCGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCCGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCTGGTACTATGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACTGCAGAGGTGCGGATTGCTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGACGCCACCGGACTCGGCGTGGTCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGGTTGGCTGGGTTGCAGCGAGGGTGAAACTTCTGCAGCCCCGGGCTTTGCGGTGTTTCCGGTGCCTGGATAAGGGGCACGTCCGGGCAAAGTGCACCGCTGAAGTTGACCGCAGTGACCTTTGTTATCGCTGCGGTCAGCCCGGCCACAAGGCGGCTCAGTGTTCCGCGGCGCTCAACTGCAGCTTGTGTTCAGCTGCAGGGAAGCCAGCGGGACACAGGCTGGGTGGAGGAGCCTGTGGCGCACCAGCCAGCGAGGCCAAGAAGAAGAAGAGGAACTCAAAACCTGCCGGGGAAACCTCGCTACCCCCGCAGGCTAGTAGCTCCGGCAATATCAATCACTGTGCCAGAGCTCAGGATATTTTACTCCAGAGCATGGCAGAGTGGTCGATCCACGTGGCTGTGGTCGCCGAACCGTATTTTGTCCCCGCCCGTGACAACTGGCTGGGGAGCATTGACGGCTTGGTGGCCATTATCGGCCAGACCCTGATCAACCCGTCTCGGGGCCGCGGCTGGGTTGCTGCGGTCTCGGACGGTATCGGCATTGTAGGGGCGTATTTTTCTCCCAACAAGAGTCTCGCCGACTTTGAGGGGTTCCTCGTCGAGTTGGGCGCCGTCGTAGGCCGCTATCACCCTCGTCCCGTTCTGGTGCTCGGGGATCTCAACGCCAAGTCATCGGCGTGGGGATCTCCGGTCACTGACCATCGGGGCGAGGTGCTAGAAGAGTGGGCGGTGACAACTGGTCTGGTCGTCCTGAATCGGGGTTCGGAATACACGTGCGTGCGGCAGCGGGGCGGCTCGATAGTGGACGTCTCGTTTGCTAGCCCCTCTGTCGCCAGCCGAGTCCGCGACTGGCGTGTCGCCGTGGAGGTAGAGACGCTGTCGGACCATCGGTATATCCGGTTCGACGTCTCTGCCCAGACCGCGAGCGGCCGCCAGCCAACAGCCCCGATTAACGACGGCCCACGCTGGGCACTTAAGCGCATCGACAAGGAGCTACTCGAGGAAGCTGCCTTAGTCCAGTCCTGGATTTGGGAGTCGACAATGAACGGTCCCGTCGACGTCGAAGCGGTGGCGCTGTGGTTTCGAGGGGCGATGACGCAGATCTGCGACGCGTCCATGCCCCGGGTCCACCAACAGTCCGCAAGGCGCCAGGTGTACTGGTGGACCGACGAGATCGCGCGGCTGCGCGTTGAGTGCGTCGCGGCTCGCCGCCGGTACACGCGATACCGGAGACGACGTCGACGGGATTCCGTCGAGGAAGACGCGCTGTATGAGGCGTACCGCGCGTCTAAGGAGACTCTGTGGCTGGCCATCGGCGACTCTAAGTCGCGTGCCAGGGAGGAGCTGCTGGGCATGCAACCCCAGTTGCTAGAAGCGGTTGTATCGGCCCTCTTCCCTGAGCGAGCGGAATACGTTTCCCCGGCGATGGCTTCACCCTCAGCCACAGACTCTCGAGAAGAGGAAAGCACCGATGTCCCCGAGGTGACGCAAGCAGAGATGAGAGCGGCCGTGTTGCGACTCCGGTCTAAGAACACGGCCCCGGGACCCGACGGAGTTCCTGGTCGAGCACTCGTCCTGGCTCTGAAGGAGCTAGAGCCCCAGCTGAGGGGGCTCTTCACGGCATGTCTCGAGCAGGGTCAGTTTCCTAGTGTATGGAAGGAGGGGAAGCTGGTCCTGCTCAGGAAGGAGGGGCGCCCCGCGGACTCGCCGTCCGCGTATCGGCCCATAGTGCTGCTCGATGAGGCGGGCAAACTTTTTGAGCGCATTATCGCAGATCGCCTCGTCAGCCACTTGTGCAGGGAGGGGCCGGACCTGGATGACAACCAATTTGGTTTTCGTCGGGGGCGCTCCACCATAGACGCCATCATGCGTGTGAGGGCCCTGGCGGAGGAGACGGTGTCCCGGGGTGGGGTGGTACTGGCGGTGTCTTTAGACATCTCCAACGCTTTCAACACCCTACCCTGGAGTTGTATTCGGGAGGCTCTGAAATACCATCGCGTGCCTCCCTACCTCCGCCGCACGGTAGGGGCTTATCTGGAGGGTAGATGCGTCACTTATCGGGGACGTGACGGTGCCGGTCGGCACCTCATGTCGTGCGGTGTTCCACAGGGATCGGTCTTGGGACCGCTCCTGTGGAACATCGGCTACGACTGGGTGCTGAGAGGCGAGCTCCCGTCGGGCGCCAACTTGACGTGTTATGCGGACGACACGCTTGTCACTGCCCGGGGGAGCTCGCACAGGGAAGCGACGTTGATAGCCGCGGCTGCGGTGTCACTGGTGGTGAACCGCATCCGGCGCCTGGGCCTGGAGGTGGCCCTAAACAAGTCGGAGGCTATGGTGTTTCATGGCCCCCGACGTGCGCCGGCGCCGGGATCACACATCGTGGTAAGTGGGACCCGGATAGCTGTCGAGTCCACCATGAAGTATCTGGGATTGGTGCTCGACAGCCGATGGGAATTCGGGCCCCACTTCCGGCGGCTGGTGCCCAAGCTGATGGGTGCAGCGGGCGCGCTTTCAACGTTGCTTCCCAATTTGGGGGGCCCGAGCGCCGCCTGTAGGCGGTTGTACGTGGGAATCGTGCGGTCCATGGCCCTGTATGGGGCCCCTGTGTGGGCGATGGACATGACGGCCAGCACACTCGCCATTCTGCGTAAGCCGCAGAGGGTGATGGCCGTCAGAGTCATCCGCGGGTACCGCACGATTTCCTACGAGGCGGCTTGCGTCCTGGCCGGATCCCCGCCCTGGGACCTAGAGGCGAAAGTACTCGCGTCATTATATCGATGGCGCGAGGAAGAGCGGGCACGGGGCTCGAGGCTGGTGCAGCGGCAGATCGCGCTGCGCCGAGAGGAGCTCCGTCTGGCCTTGGTGGCGGAATGGCGGCAAAGGCTTCTGCGCCCTACCGCCGGCCTCGCAACCGTCGAGGCGATCCGGCCAGTACTCGACGACTGGCTCGGGAGAAGGCACGGATCCCTGTCGTTTAGGGTGACACAGGTGCTGTCGGGGCACGGTTGCTTCGGCAAGTACCTGTGCCGCATAGACAGGGAGCCGGACGCTCGGTGCCACCACTGCGTCCACTGCGGGGAGGACACGGCGCAACACACGCTCGCCGAGTGTGTAGCTTGGGAGGAGCAGCGCCGTGTCCTCACAAATGAAGTAGGAAGCGATCTGTCGCTGCCGGCCGTAGTGCGGAGGATGGTCGGCAGCGCAGAGTCGTGGGACGCGGTGGTGTCCTTCTGCGAGGACGTGATGTCGCAGAAGGAAACTGCAGAACGGGAGAGGGAGATCTCGACTCCCTTTCCCGGCCGCAGAAGGCGCACCGGGCGCAGGACAAGGGCGGACAATGCCCTTTTCCGCCCCCCATGA
Protein
MANYERDLSYDPADARRSQVPGPASDKLVTDGRAGVGDQAPVADNITGSSYFENIDGGPRGSSSVRKRSRDNAPVGDGSVDLSSDEEGLLPPKKLPTTRRGRQASRGVSASRPRRNAQGRFVCSNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADEVSEMARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPAIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVAGTMSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRIAGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVVWVRCPVASAKKIALSGRLLVGWVAARVKLLQPRALRCFRCLDKGHVRAKCTAEVDRSDLCYRCGQPGHKAAQCSAALNCSLCSAAGKPAGHRLGGGACGAPASEAKKKKRNSKPAGETSLPPQASSSGNINHCARAQDILLQSMAEWSIHVAVVAEPYFVPARDNWLGSIDGLVAIIGQTLINPSRGRGWVAAVSDGIGIVGAYFSPNKSLADFEGFLVELGAVVGRYHPRPVLVLGDLNAKSSAWGSPVTDHRGEVLEEWAVTTGLVVLNRGSEYTCVRQRGGSIVDVSFASPSVASRVRDWRVAVEVETLSDHRYIRFDVSAQTASGRQPTAPINDGPRWALKRIDKELLEEAALVQSWIWESTMNGPVDVEAVALWFRGAMTQICDASMPRVHQQSARRQVYWWTDEIARLRVECVAARRRYTRYRRRRRRDSVEEDALYEAYRASKETLWLAIGDSKSRAREELLGMQPQLLEAVVSALFPERAEYVSPAMASPSATDSREEESTDVPEVTQAEMRAAVLRLRSKNTAPGPDGVPGRALVLALKELEPQLRGLFTACLEQGQFPSVWKEGKLVLLRKEGRPADSPSAYRPIVLLDEAGKLFERIIADRLVSHLCREGPDLDDNQFGFRRGRSTIDAIMRVRALAEETVSRGGVVLAVSLDISNAFNTLPWSCIREALKYHRVPPYLRRTVGAYLEGRCVTYRGRDGAGRHLMSCGVPQGSVLGPLLWNIGYDWVLRGELPSGANLTCYADDTLVTARGSSHREATLIAAAAVSLVVNRIRRLGLEVALNKSEAMVFHGPRRAPAPGSHIVVSGTRIAVESTMKYLGLVLDSRWEFGPHFRRLVPKLMGAAGALSTLLPNLGGPSAACRRLYVGIVRSMALYGAPVWAMDMTASTLAILRKPQRVMAVRVIRGYRTISYEAACVLAGSPPWDLEAKVLASLYRWREEERARGSRLVQRQIALRREELRLALVAEWRQRLLRPTAGLATVEAIRPVLDDWLGRRHGSLSFRVTQVLSGHGCFGKYLCRIDREPDARCHHCVHCGEDTAQHTLAECVAWEEQRRVLTNEVGSDLSLPAVVRRMVGSAESWDAVVSFCEDVMSQKETAEREREISTPFPGRRRRTGRRTRADNALFRPP

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=4.95181e-09,     Score=152

Ontologies

Topology

Length:
1718
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.533149999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1718
 
 

Population Genetic Test Statistics

Pi
227.358471
Theta
158.298323
Tajima's D
1.897252
CLR
0.622645
CSRT
0.866356682165892
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号