SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05499
Pre Gene Modal
BGIBMGA006623
Annotation
PREDICTED:_serine/threonine-protein_kinase_NLK_isoform_X1_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.763
 

Sequence

CDS
ATGGCAAGACGACGATCAAAAAGCCAGTCCTTCGATGACGACGACAGTATTTTCGATCGACCAACGCGTGGTGGAATGTTTCACTTAACGGAGAATATCATCAGGAAGTTTGACGGCAAAGACAAAACTTATGCTGTAACAAAGTGGATACAAGATATAGAGGAAAATGGTGACATATTCGAGTGGACACCAAAGCAACGGTTATTAGTGGCTCGACGGTCATTAACCGGCACGGCAGCTTTGTGGTTAAATTCTGAAAAAACGTTTCCATGCTGGGATACTTTAAAGATAGCCATCAGTAAGGAGTTCCCTGACACCATAGACGCCAAGACTATTCACGAAATGATGAGTGCTAAAAAGAAAAAGTCAAATGAATCATGCATTGACTACATGTTTGCCATGAAAGAACTTGGACGCCGAGGCAAAATGGCGGACTACGTGGCTATAAAATATGTTGTAGATGGCATACAAGATCAAGAAATAAATAAAATAATGCTATATGGAGTCACAACGTACGCTGAATTAAAGGAGAAATTAAAAATATACGAGATTTTGAAAGAAAAAATGAAGAAAGAACCTATTTACGGAAAAGAGCAGAAAATTACTAATACAAGAGAATGGTCATCAAAAGTTCGATGCTATAGCTGTGGAGAGAAGAGTCATAAAAGTGAAGATTGCCCGAAAAAGATGCAAGGAAAAAAGTGTTTCAACTGCAACGTGTTCGGCCATATTTCTTCACAATGTCCGGCAAAGGCGGAAGCGTCATCGGCTACGGCTAGCAGCGCGAGAACGGAGCAGCAACCGAAACGCACGTATATCGCTACGACGCAGGAGGGCGCGAACACAATTTTCGAAAATCAATCTGACGAAGTTCACAACGCTATGAATGCTGTGATTGGCTCTGCGAACAGTACGGTGCGCGACAAATGTCATAACAGTGAGGTTGACATTTTAAAAGTAAATAAAGAATGTAAAGTGTTGAAAAAAACTTTGAAATTAGTAAAATTGTGTAATAATAACGAAATTCATGCATTAATTGATACTGGTAGTGAAGTTAATTTAGTAACCATGGACTATTATGAGCAAATAGGCTCTCCGACGTGTTTTAAAAATGTAAACACAGTTCTTACCGGTTTAGGCTCATCAAAGGTAATATCAAGTGAACAATTTAAAACAAACATTGAAATCGACGGCTACACGTATCGTGATATAATATTTTATGTGATTCCTAGAGACAGTATACCTATTAAAGTGATATTGGGACATGAATTTTTAAGAAATGTTATTACAGTTATGAAAGATGGTTTGGTATGGATGAAACCAAATGATTGGTTGTTTAAGGTAAATTGTTTTCCATGTTCTATTGACATTGTAGGTCATGTTATGAATGAAAATGTGAGGAATGAAGTGACTAGGTTAGTAGATGAATATCGGCCATGTCAAACTAAAGAGGCTCCCATTGAGTTGAAAATCACACTTAAAGACGACATCCCAGTGGCTCAACGACCACGACGCATCTCACCAAAAGAACAGGATGAGGTGATCAAGTACGCATATGTGATCACGGAGCTTCTGCAGAGTGACCTACACAAGATCATCGTGTCGCCCCAACATTTATCAGCGGACCACATTAAAGTCTTTCTGTACCAGATACTGAGAGGTCTCAAATACCTGCATTCCGCAAGGATTCTTCATCGCGATATCAAGCCAGGAAACTTGTTAGTGAACAGCAACTGCGTACTTAAGATATGCGATTTCGGATTGGCGCGAGTCGAAGAGCCGGACGCAAACAAAAACATGACGCAGGAGGTCGTGACCCAATATTACAGAGCCCCTGAGATTCTGATGGGAGCGAACCATTACACAGCAGCTGTTGACGTCTGGTCGGTCGGCTGTATATTCGGCGAGCTACTTGGCAGGCGTATCTTATTCCAGGCACAGAGTCCCGTTCAACAGTTGGAGTTGATAACTGATCTGCTGGGCACGCCGTCGCTTGAGGATATGCGTCACGCGTGTGCAGGAGCCCGCGCACACATGCTTCGCCGCGCGCCCCGCCCCCCTGCCCTCGCGGCCCTCTACACGCTCTCCGTTCAAGCCACACACGAGGCCGTGCATCTACTCGCGCAGATGTTGGTATTCGATCCAGCCAAGAGGATTTCCGTAGTGGACGCACTAGCACATCCTTACCTCGAAGAAGGGCGACTCCGTTATCACTCATGCATGTGCAAGTGCTGTTACAACGCCCCCCCAGCAGCCAGGCACTATTCTCCAGACTTGGAGCCGGTGGCGCCGCATCCCTTCCACGATGCATGGGAACGGAAGCTCACCTCCGTGCATCAGGTCAAAGAGGAGATACACAAGTTCATAGCGGAGCAGCTCCAAACGTCTCGCGTTCCGCTCTGCATCAACCCGCAGTCCGCCGCGTTCAAGAGCTTCGCAAGCTCGACAGTGGCGCATCCATCCGAGCTCCCGCCGTCGCCGCACCAGTGGGAATGA
Protein
MARRRSKSQSFDDDDSIFDRPTRGGMFHLTENIIRKFDGKDKTYAVTKWIQDIEENGDIFEWTPKQRLLVARRSLTGTAALWLNSEKTFPCWDTLKIAISKEFPDTIDAKTIHEMMSAKKKKSNESCIDYMFAMKELGRRGKMADYVAIKYVVDGIQDQEINKIMLYGVTTYAELKEKLKIYEILKEKMKKEPIYGKEQKITNTREWSSKVRCYSCGEKSHKSEDCPKKMQGKKCFNCNVFGHISSQCPAKAEASSATASSARTEQQPKRTYIATTQEGANTIFENQSDEVHNAMNAVIGSANSTVRDKCHNSEVDILKVNKECKVLKKTLKLVKLCNNNEIHALIDTGSEVNLVTMDYYEQIGSPTCFKNVNTVLTGLGSSKVISSEQFKTNIEIDGYTYRDIIFYVIPRDSIPIKVILGHEFLRNVITVMKDGLVWMKPNDWLFKVNCFPCSIDIVGHVMNENVRNEVTRLVDEYRPCQTKEAPIELKITLKDDIPVAQRPRRISPKEQDEVIKYAYVITELLQSDLHKIIVSPQHLSADHIKVFLYQILRGLKYLHSARILHRDIKPGNLLVNSNCVLKICDFGLARVEEPDANKNMTQEVVTQYYRAPEILMGANHYTAAVDVWSVGCIFGELLGRRILFQAQSPVQQLELITDLLGTPSLEDMRHACAGARAHMLRRAPRPPALAALYTLSVQATHEAVHLLAQMLVFDPAKRISVVDALAHPYLEEGRLRYHSCMCKCCYNAPPAARHYSPDLEPVAPHPFHDAWERKLTSVHQVKEEIHKFIAEQLQTSRVPLCINPQSAAFKSFASSTVAHPSELPPSPHQWE

Summary

Uniprot
ProteinModelPortal
PDB
5O7I     E-value=2.84506e-54,     Score=539

Ontologies

Topology

Length:
831
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03433
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00064
outside
1  -  831
 
 

Population Genetic Test Statistics

Pi
207.364634
Theta
163.371606
Tajima's D
0.599475
CLR
0.460998
CSRT
0.542472876356182
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号