SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05497
Pre Gene Modal
BGIBMGA006717
Annotation
PREDICTED:_integrin_alpha-IIb-like_[Bombyx_mori]
Full name
Integrin alpha-IIb      
Alternative Name
GPalpha IIb
Platelet membrane glycoprotein IIb
Location in the cell
PlasmaMembrane   Reliability : 2.219
 

Sequence

CDS
ATGTACGACCACAATTACTGGCTCGGCGCAACTGTGGAGGCTGGACCGACTTTTTTTGTTACTTGCGCTCCACTACTGGTCCACAACATGAGAATAGGCACTGGATCGACCGGAGGATGCTTCATTTCGAAGAACGATTTCTCAATTGAAAAACTTTTTCTAAGAAGGGAGAATTCTCCTATCAGAACATTAAAAGGCCTGATGTCGTCCTACGGTTGGAGTTTAGCGGTTAGTGATAAAAATTCTGTTGTAGTCGGAGGACCTGGCATTTCTAATGGGAAAACTTTACTATACATGACGCCAGAGCCTTCTACTCAACCTGACATCTTGGACGGTATGGATATGAATGTCAATTTCAATTTCGGGTACAGCGTGACGACAGGATACTTTGCAACACCTAAGCTTTTAATGTACGCAGTCAGTAGTACGTACCGCTTAGGGCAGGTTTTATTTTACGGAGAGCAGTGGAGGTTTTTTAAGCAACTTAAGTTCGAACAACCGAAGACGACTGTCGGGGAGATGTTTGGCGCTAGTTTGTGCTCGGCTCGTATCTTCGGCCCACGATCAGACTTGTTAGTCGGAGCTCCGGGACGAGCGAGCGACAAGCAATACAACGTAGGCGCTGTCTACGTATTTGTTGCCGAAAAACCAATGGCTCTAAGTTTCAAAAGGATCATCACTGGCCGAAAGGAAGGCTCGATGTTTGGCAGCGCCATCATCAATATTGGAGACTTGAACGGCGACAGAAAAGACGACATCGCGATAGCGGCGCCATTTGAAAATGACGGTCGAGGGGCAGTGTATCTATATTGCGGCGCTGAAATCCTGGGTAGCAAGGAGAAGAAAAAGCCTTTTAGTTTCTTACAAGTGATCGAATCGGAGGACCATGGATTCGGCCTAGCGCTTAGCGTTTTGAAAGACTACGATCAAAATGGATGTAACGAATTGGCCATTGGTAGTCCATTCAATGACACTGTATACGTTCTACCATGCTTCGCCTACGTCACTGTGCAGTTGTATACTGAATTCCCAGATTTACAGAATCAAGTGATTAAAAACAAAGGTGGAGGTAAAGAGTTCCTTTTCAAGTCTTGCCTGCATGTTACATACCCAAAGAAGCCTGCAAAAGCATATGCCGAAATAGAAGTGCAGGTAGAAATATCAGGCAATACGAACGCATCATTAAGTAACCCGGGTTCCGATGGAAAATACAAAGTGAAAATCGAGAAAACAAATGAACAAACTGAACAGAACCTCTGCAAACAGATCGGTGTCTTTATGCCGAAGGACGGGCAATACGACTCGCCGATAAACGTTAAGATTACTGCGAAACAAATAAATGATCCTCAGCATCAATCGCACTTCGATCCATCCCACGTTCGTATACATGAAAGCAGTCTTTTGACTCTAGGCCACGATGTTTGGGCCGCACAATGCCAAAATAAAATGTCTTGTCTACCTGATATTAGATTGAACATCGTCAATATGTTTCCAGAGCCGTATCTGCTTGGCTCGTCGGAGACGGAGGACATCAAAATGGAGATAAAAAACCACGGCGAGGTGGCTTACAGCGCTTGCCTTAAAGTGGACGTCATCAACGCGGCCATTGTGAGAGCCCCCGCTCTCAGCTGCACTATTAGTCACCACGACTACTCGCTGACATGTATCTCACAGAAACCAATTCATACAAACGACACATGGGACTTAGGTAATATATCACTGAAAATGACACAGGCCACAAATAAAGACGAATTTATAACAATAAGAGTAAAAGTCTTTGGTAACTGCAAGCTTACTCAGAACTTTACGCTGATCGAAAAACAATATAAGCTAACAAGAGATCTTGACGACATAGAAATTATAGGGAGAGCCAGCTTAGGAACTAACATTACATTGACAGCTGAAGAAATTAAACTTGAACAGAAAAACTTGGACCATATTTATACAATAAGGAATAAAGTAGAGAACCCTTGGATTGGAGGTCCAACGCTCCAAATAACTTTTATGAATCTTCAGTACCTGCAATACACGAAAACGCCGATAATTGCCCAAACCGAGACAGGAGTCGAACTAGATTGTGCAATCATAAGTACGGACAGCAAAATAACGACAAATTGCACGGCGGACAAACTGGTGAAAGGCGACCAGATTAATGTGATTATACATATGAATGTCGATCCTTCGAAAATAGATGACGTGATGTCCCTTGAGAATTTAATCGTAGAGTCGAAGATTGAAGTATTCCCAGGCAGTTTATGGAGTGAGCCTTCCTCGAAGACAATTTTATCTCAAAGTGTTGTGACTACTGTTACTATCGAGAAAACGACGGTAGCCCTCTGGATCATAGTTGTGGCATCGCTATTGGGTCTACTGCTTCTCAGCATCATATACTGCATTGTCGTCAAACGAACAAATCTGTTACGTAGGAAGAATAAGGAAAAGACAAAGGTTCTAAGAAAGAGTATTAGAAGGCAAACTATGAGACGTTCGATGATGGCGCAGTCCGCTTATGGAAGACTTCCAGAAGACGAGCCTCGCGCTCTGAGCGTCGTTCAAGAAGATCTCCAGCTGTGCGAAACGCAATCATTTTATCTCTAA
Protein
MYDHNYWLGATVEAGPTFFVTCAPLLVHNMRIGTGSTGGCFISKNDFSIEKLFLRRENSPIRTLKGLMSSYGWSLAVSDKNSVVVGGPGISNGKTLLYMTPEPSTQPDILDGMDMNVNFNFGYSVTTGYFATPKLLMYAVSSTYRLGQVLFYGEQWRFFKQLKFEQPKTTVGEMFGASLCSARIFGPRSDLLVGAPGRASDKQYNVGAVYVFVAEKPMALSFKRIITGRKEGSMFGSAIINIGDLNGDRKDDIAIAAPFENDGRGAVYLYCGAEILGSKEKKKPFSFLQVIESEDHGFGLALSVLKDYDQNGCNELAIGSPFNDTVYVLPCFAYVTVQLYTEFPDLQNQVIKNKGGGKEFLFKSCLHVTYPKKPAKAYAEIEVQVEISGNTNASLSNPGSDGKYKVKIEKTNEQTEQNLCKQIGVFMPKDGQYDSPINVKITAKQINDPQHQSHFDPSHVRIHESSLLTLGHDVWAAQCQNKMSCLPDIRLNIVNMFPEPYLLGSSETEDIKMEIKNHGEVAYSACLKVDVINAAIVRAPALSCTISHHDYSLTCISQKPIHTNDTWDLGNISLKMTQATNKDEFITIRVKVFGNCKLTQNFTLIEKQYKLTRDLDDIEIIGRASLGTNITLTAEEIKLEQKNLDHIYTIRNKVENPWIGGPTLQITFMNLQYLQYTKTPIIAQTETGVELDCAIISTDSKITTNCTADKLVKGDQINVIIHMNVDPSKIDDVMSLENLIVESKIEVFPGSLWSEPSSKTILSQSVVTTVTIEKTTVALWIIVVASLLGLLLLSIIYCIVVKRTNLLRRKNKEKTKVLRKSIRRQTMRRSMMAQSAYGRLPEDEPRALSVVQEDLQLCETQSFYL

Summary

Catalytic Activity
Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides.
Subunit
Heterodimer of an alpha and a beta subunit.
Heterodimer of an alpha and a beta subunit. The alpha subunit is composed of a heavy and a light chain linked by a disulfide bond. Alpha-IIb associates with beta-3. Directly interacts with RNF181. Interacts (via C-terminus cytoplasmic tail region) with CIB1; the interaction is direct and calcium-dependent. Interacts (via C-terminus cytoplasmic tail region) with CIB2, CIB3 and CIB4; the interactions are stabilized/increased in a calcium and magnesium-dependent manner (By similarity).
Similarity
Belongs to the integrin alpha chain family.
Belongs to the peptidase M24A family. Methionine aminopeptidase type 1 subfamily.
Keywords
Calcium   Cell adhesion   Complete proteome   Disulfide bond   Glycoprotein   Integrin   Membrane   Metal-binding   Receptor   Reference proteome   Repeat   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Integrin alpha-IIb
Pfam
PF01839   FG-GAP        + More
PF08441   Integrin_alpha2
PF00557   Peptidase_M24
PF00246   Peptidase_M14
PF00357   Integrin_alpha
Interpro
IPR000413   Integrin_alpha        + More
IPR013519   Int_alpha_beta-p       
IPR013517   FG-GAP       
IPR028994   Integrin_alpha_N       
IPR013649   Integrin_alpha-2       
IPR032695   Integrin_dom_sf       
IPR018184   Integrin_alpha_C_CS       
IPR002467   Pept_M24A_MAP1       
IPR000994   Pept_M24       
IPR036005   Creatinase/aminopeptidase-like       
IPR017868   Filamin/ABP280_repeat-like       
IPR034223   IGCP-like_CPD       
IPR000834   Peptidase_M14       
SUPFAM
SSF69179   SSF69179        + More
SSF55920   SSF55920       
Gene 3D
PDB
4CAK     E-value=2.95939e-21,     Score=255

Ontologies

Topology

Subcellular location
Membrane  
Length:
865
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
39.5041
Exp number, first 60 AAs:
11.03573
Total prob of N-in:
0.34474
POSSIBLE N-term signal
sequence
outside
1  -  778
TMhelix
779  -  801
inside
802  -  865
 
 

Population Genetic Test Statistics

Pi
28.304422
Theta
2.05106
Tajima's D
-1.532757
CLR
208.703613
CSRT
0.0445477726113694
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号