SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05496
Pre Gene Modal
BGIBMGA006716
Annotation
integrin_alpha-PS4-like_[Bombyx_mori]
Full name
Integrin alpha-PS4      
Alternative Name
Position-specific antigen subunit alpha-4
Location in the cell
Cytoplasmic   Reliability : 1.622
 

Sequence

CDS
ATGCTAAATTTAATAGTTACCGCTCCGATAGCAGATAATATAGGGCAAGTTTACGTTTGCCAAATCGACAACTTACACTGCAAGCCAATTGAAAGGAATATCGTAAGAGACAATAGTAAATACGATCATAACTACTGGCTCGGAGCGACTGTGGAAGCTGGGTCATCATTTTTCGTGACCTGCGCTCCACTGCTGGTCAAACATAGCGAAAATGGTGTTGGAACGACGGGAGGGTGCTTCATTTCGAAAGATAATCTTTCAATTGAACAATTTGTCCTCGATCAGAATGGCTCCCCAAAAAATACAACATTCGAATCTCGATTATCTTCCTTCGGTTGGAGTCTGACTATCAGCGACCAGGAATCTATTGTTGTTGGAGGACCTGCTATGTATACTGGTCGCACTTTACTGTACATGAAGCCGGAAGCTTCTAATTCACCGTATGTTGCGGCAGGCATCGACAACGATGTGGACTTCAATTTTGGGTATAGTGTGACGTCAGGATATTTCGCAACATCTAAATTGCTAATGTACGCAGTGGGTAGCCCATACGGTTTCGGAAAGGTTTTATTTTTCGGACAACAGTGGAGGTTGTTTAAGCAACTTAAGTTCAAACAACCGAAGACGAATGTCGGGGAGATGTTTGGCGCTAGTTTGTGCTCGGCTCGTATCTTCGGACAACGATCAGACTTGTTAGTCGGAGCTCCGGGACGAGCGAGCGACAAGGAATACAACGTAGGCGCTGTCTACGTTTTTGTTGCAAACAAGCTAATGGCTCTAAACTATAAAAGGATTATTACGGGCCGAAAGGAAGGTTCGATGTTTGGCAGCGCTATTATCAATGTTGGAGATTTAAACGGAGACAAGAAAGATGATATAGCAATAGCAGCGCCATTTGAAAATGATGGTAGAGGGGTAGTCTACATCTACTGTGGCGCTGAAATTCTGGGTCTCAAAGAACCCAAAAAGCCTTTTAACTTCTTGCAAATGATAGAATCCGAAGATTATTACTATGGCTTCGGCTTGGGACTAGGCATTTTGAACGACTATGACCAAAACGGATGCAATGAATTAGCCATCGGAAGTCCGTTGAATAACACTGTGTTTATACTGCCATGTTTTGCCTATATCACCGTCGAATTGTATACCGAGTATCCAGATCTACAGAATCGAGAAATTATAAACGCAGTGGCACAAAATGATGTGAACGAAACACACTTTCGTTTTGACACCTGCCTGCGTGTAACGTTTCCGAAAAAGCCTACCAAAGCATATGCCGAACTAGAAGTGGAAATCGAAATATCGGGCGACACTAAAGCATCCCTAAGTGACCCAAATTCAGATAAAAAATACATAGTGAAAATCGAGAAAACGACTAAACAATCTGTTCAACAGTTCTGCAAGAAGATTGGTGTCTATCTGCCAACGGACGGACATTACGATTCACCAATAAAATTTAAGATTATTGCGAAGCAAATAAATGATCCACAACTACAATCAAATCCGGAACCATCCCACGTTGTCGTCAATGAAAACAGTATTTTAACTCTACGACATGATATCTGGGCAGCGCAATGTAAAAATAAAATGTCGTGTTTGCCTGACATTCATTTGGATATCACGAACCTATTTCCAGAGCCCTATCTGCTTGGCTCGTCGGAGACGGAGGACATACAGATGAAGGTAACAAACCACGGCGAGGTGGCTTACAGCGCCTGCCTTAAAGTGGACGTCGTCAACGCGGCCGTTGTGCGAGCCTCTGCTCTCAGCTGCACCATTGGTGACCAAGAGAATACTCTTACATGCATTTCACAGAAACCAATTCATAAAAACGATCCCTGGGACATTGGTCATATATCATTGAAAATGACAGACGCCACAAACAAAGACGAATTCATAACACTTAAAGTAAGAGTCTATAACAACTGCAAGACTCCTAAGATATTTACGCTGATTGAAAAACAATATAAACTGACGAGAGATCTTAATGATATAGAAATTATAGGAAGAACTAATCTAGGAAGCGTCATAAACACAACAGTAGAAGAAATAAAGTTTGAGAAGAAAATCTTAGAACATATTTACACAATTAGCAACAAAGTGGCGAACCCGTGGCTTGGAGGTCCAAAGTTCAAAATCACCTCCATGACACCCCATTTTCTGCACTATACCAAATCACCTGTCACAGTGAGTTATGAAAAATCTAAGTTAATAATCATAAATTATACTAATTTAAAAATGTAA
Protein
MLNLIVTAPIADNIGQVYVCQIDNLHCKPIERNIVRDNSKYDHNYWLGATVEAGSSFFVTCAPLLVKHSENGVGTTGGCFISKDNLSIEQFVLDQNGSPKNTTFESRLSSFGWSLTISDQESIVVGGPAMYTGRTLLYMKPEASNSPYVAAGIDNDVDFNFGYSVTSGYFATSKLLMYAVGSPYGFGKVLFFGQQWRLFKQLKFKQPKTNVGEMFGASLCSARIFGQRSDLLVGAPGRASDKEYNVGAVYVFVANKLMALNYKRIITGRKEGSMFGSAIINVGDLNGDKKDDIAIAAPFENDGRGVVYIYCGAEILGLKEPKKPFNFLQMIESEDYYYGFGLGLGILNDYDQNGCNELAIGSPLNNTVFILPCFAYITVELYTEYPDLQNREIINAVAQNDVNETHFRFDTCLRVTFPKKPTKAYAELEVEIEISGDTKASLSDPNSDKKYIVKIEKTTKQSVQQFCKKIGVYLPTDGHYDSPIKFKIIAKQINDPQLQSNPEPSHVVVNENSILTLRHDIWAAQCKNKMSCLPDIHLDITNLFPEPYLLGSSETEDIQMKVTNHGEVAYSACLKVDVVNAAVVRASALSCTIGDQENTLTCISQKPIHKNDPWDIGHISLKMTDATNKDEFITLKVRVYNNCKTPKIFTLIEKQYKLTRDLNDIEIIGRTNLGSVINTTVEEIKFEKKILEHIYTISNKVANPWLGGPKFKITSMTPHFLHYTKSPVTVSYEKSKLIIINYTNLKM

Summary

Description
Possible role in cell adhesion. Minor involvement in the establishment of the oocyte anterior-posterior length.
Subunit
Heterodimer of an alpha and a beta subunit.
Heterodimer of an alpha and a beta subunit. Alpha-PS4 associates with beta-PS (By similarity).
Similarity
Belongs to the integrin alpha chain family.
Keywords
Cell adhesion   Complete proteome   Glycoprotein   Integrin   Membrane   Receptor   Reference proteome   Repeat   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Integrin alpha-PS4
EMBL
KJ511851    AII79410.1    BABH01008474    KJ511852    AII79411.1    DQ531844    + More
ABF59518.1    ODYU01004083    SOQ43584.1    NWSH01001781    PCG70156.1    NWSH01000931    PCG73502.1    RSAL01000201    RVE44446.1    AGBW02008132    OWR54131.1    KQ458793    KPJ05055.1    AGBW02011645    OWR46348.1    KQ459984    KPJ19044.1    KQ461194    KPJ06885.1    UFQT01001465    SSX30678.1    RSAL01000043    RVE50694.1    AGBW02010302    OWR48769.1    KQ459603    KPI92953.1    DQ531846    ABF59520.1    KJ511850    AII79409.1    PCG70155.1    RVE44447.1    KJ511853    AII79412.1    KPJ05054.1    UFQT01000196    SSX21531.1    GAMC01021441    JAB85114.1    GL444716    EFN60653.1    KQ982769    KYQ50932.1    GL888739    EGI58217.1    KZ288285    PBC29468.1    KK108839    EZA46609.1    QOIP01000009    RLU18616.1    KQ976401    KYM92650.1    CM000362    EDX07190.1    CM002911    KMY93933.1    KQ977444    KYN02758.1    AAMC01116227    BC166262    AAI66262.1    KQ434787    KZC05299.1    GDIQ01084793    JAN09944.1    GDIQ01183251    JAK68474.1    GDIQ01006722    JAN88015.1    GDIQ01095273    JAL56453.1    GDIQ01176541    JAK75184.1    NWSH01000832    PCG73951.1    GDIQ01117966    JAL33760.1    KQ981335    KYN42577.1    KQ760551    OAD59829.1    GDIQ01078282    JAN16455.1    GDIQ01095274    JAL56452.1    BC077891    AAH77891.1    CM004483    OCT60024.1    OCT60025.1    OUUW01000001    SPP75911.1    AE013599    BT023104    BT128883    SPP75912.1    CM004482    OCT62194.1    BC084201    AAH84201.1    GDIQ01075841    JAN18896.1    KMY93932.1    GBXI01014337    GBXI01003157    JAC99954.1    JAD11135.1    EDX07189.1    KMY93931.1    CM000158    EDW91128.1    GL763764    EFZ19346.1    CH933808    EDW08388.1    CH480816    EDW47967.1    GBXI01009292    JAD05000.1    ADTU01026806    ADTU01026807    ADTU01026808    AY237587    AAO85805.1    GDIP01094590    JAM09125.1    GDIP01094589    JAM09126.1    LRGB01000512    KZS18876.1    GDIP01085627    JAM18088.1    GDIP01188768    GDIP01188767    JAJ34635.1    GL451328    EFN79466.1    GDIQ01230027    JAK21698.1    JXUM01005310    KQ560190    KXJ83915.1    NNAY01003194    OXU19825.1    GFDG01002632    JAV16167.1    GFDG01002631    JAV16168.1    GEZM01062083    JAV70050.1    GFDG01002630    JAV16169.1   
Pfam
PF01839   FG-GAP        + More
PF08441   Integrin_alpha2
PF00246   Peptidase_M14
PF00357   Integrin_alpha
Interpro
IPR028994   Integrin_alpha_N        + More
IPR000413   Integrin_alpha       
IPR013519   Int_alpha_beta-p       
IPR013517   FG-GAP       
IPR013649   Integrin_alpha-2       
IPR032695   Integrin_dom_sf       
IPR018184   Integrin_alpha_C_CS       
IPR034223   IGCP-like_CPD       
IPR000834   Peptidase_M14       
SUPFAM
SSF69179   SSF69179       
Gene 3D
PDB
4CAK     E-value=1.31269e-19,     Score=240

Ontologies

Topology

Subcellular location
Membrane  
Length:
747
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.784739999999996
Exp number, first 60 AAs:
0.1983
Total prob of N-in:
0.02449
outside
1  -  747
 
 

Population Genetic Test Statistics

Pi
242.601619
Theta
177.796239
Tajima's D
0.80817
CLR
0.080371
CSRT
0.609319534023299
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号