SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05432
Annotation
blastopia_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.544
 

Sequence

CDS
ATGGACGCTGTGCCAAAGTTCACGGGTGATGACATCACGTACTCTTCTGCGAAGTGGACACAAGATCTCGACGATAATGCCGATATATTTGGGTGGAGCCAGCAGCAGAAACTCATTATAGCGCGACGATGTTTAGCTGGAACAGCAGAATTATGGCTAAAAAGCGAAAAAACTTTCAGAAGTTACGAAGAACTAAAAGTGGCTTTGATGAAGGAATTCCCTGAGGTGATAAACAGTAAACAAATGCATGAGACAATGAGCAGACGGAAAAAACAACCCAATGAGTCGTTTTATCAATATATGCTCGTAATGAAAGAACTCGGAAAAAGAGCTAAGTTTCCGGATTACGTCGCGATTCAGTATATAATCGACGGAATATCTGACTATGAATCTAACAAGTTGTTACTCTACGGGGTAACGTCGTATTCTGTGCTCAAGGAGAAATTAGTATTATATGAAAGTTTCAAAGAGAAGTCCAAAAAAAGTGTTGATACCATGAGACGAGGTCAGCGAGACACGGCGGTAATGCCTAGGCAGATTCATCGATGTTACAATTGTGGTGAAAGAGGGCACCTATCTAGTTCCTGCCGCAGAGGTATCAAATGCTTCAAGTGCAACGGGTTCGGGCACAAGGGTACGGAGTGCCGCGCATCACAAGGTATGGAAGCTAAAAAAGCATCAAATAATTATTATGGAGGAGGTGATGAACAAGATCGGCGATCTATGTTTGTTCGACAGCAGGAGGACGACGAGAAGAACGAGAACGAACTATACGAACGTGAGCAATGCGATTTAAAAGAGCAAGTGAGTGATATGCCAAATTTTAGTTGTCAACAACTAAATCATATTGTTTCGTCAAATTTATTAAATGTAAACAAACGTGATTCTATAAACATGAGTGTAAAATCAGTAAAAGTTGGTAACTATGTGACTAATTGTTTAATTGACACAGGTAGCGACTTAAATTTAATAACTTTTGATTTGTTTACAAAACTAAAATGCGAGTACATACCAGAAAAAATGTTGCTTACTGGGTTAGGAAGCTCTAAAGTATATTCGATTGGTAAGTTCGACACAGATTTAACTATTGACAGTCACAGATATAGTATTAATTTGTATATTGTACCTACAGGTGGAATACCATATGATGTAATACTGGGTCAACAATTTTTAGTAAATACTATCACAGTTATTGACAGGGGTTTGGTTGAGGTCAGGCCTACTTGTTATGACATATCGTATCAAAATGCTATCTGTCTATCTTCCAGTAGCGATGACCGGTGTACAGCGGTGAGGGAAATTATTGACAGTTACACACCTTTGAAGACTAAAGATGCACCTATCAGGCTGAAGATTGTGTTGAAGGATGATGTACCAGTTTCACAAAGACCAAGACGACTAGCCATCACTGAAGAACAGTTAGTTAAGCAGCATGTTGATGCATTGAGCAGAAACATACTTTTTGTTGATGTCGAGTTACATGCAAGAGTGAAGAAGGCTCAAGCAGATGACGAAAGTTTGAAGGTTATCAGAAAAATCTTAGAAGAAAATGAGTATGAAGATTATTTCCTTGAGAATGGAGTTATTTACAAGGGTATAGAAAAGAAGTTGGTGTTACCTAAGATACTGGATATGGAAATTATTAAGAAAGCACATTGTACAGGACACTTTGGTAAAAAGAAGATAAGGGATATTATAGAGAAAGATTACTTTATTACTAAATTAGATAGCAAAATTGAAAAAGTAATTTCTACATGTGTACCATGTCTATTAGCAAGCAGGAAGTCTGGAAAGAAGGAAGGTTTGTTAAATCCCATAGAAAAAGGAGAATTACCACTGGATACTCTTCACTGTGATCACCTAGGACCCTTAGATGCAACTAAGAAAATGTATAACTACATACTTACTATAATTGATGGATTTACAAAGTTTGTGTGGATTTATCCAGTCAAGACTGTAACAGCAAAAGAAACTGTGGAAAAATTGAGATTACATCAAAAGGATTTTGGCAACCCACGGAGGATTATCACTGACCGAGGTACAGCATTCACAGGCAGTGAGTTCCGAGAATATTGTGAAGAAGAAGACATCGAACATGTTACAATCACTACTGGAATACCTCGTGGAAATGGCCAAGTAGAACGCATGAACAGTATTATTATTTCTGCGTTGACAAAGATGTGTATTGAAGAACCTGGTCACTGGTACAAATATACAAGCAAACTACAACAAGTGATAAACAGCACATACCAGCGGGCAATCTGTACTACGCCATTCGAACTGTTAACAGGAGTGAAACTTAAACTGAAAGAAGATTTATCAATTTTAGAATATTTAGAAGAAGAAAATAGATTGCAATTTATGAATAGGAGAGAAGAAGCACGAAGAGAAGCCAAAGCTCAAATTTTAAGAATGCAAGAGGAGAATAGAAAGACTTATAATAAACGACGTAAAGTAGGAGAAATGTACAAGGTTGGAGATCTTGTAGCTATTCAAAGGACACAATTTGGGAACGCCCTAAAATTGAAACCTAAATTTTATGGACCATATCGCATCACTAGGGAAATGGGGAAAGGTCGATATGAGGTCGAAAAAATAGACAGAAGCAAAGATGGGCCAGTACGAACTACATCAGCATTAGATTTCATGAAGAGGTGGCCTTGA
Protein
MDAVPKFTGDDITYSSAKWTQDLDDNADIFGWSQQQKLIIARRCLAGTAELWLKSEKTFRSYEELKVALMKEFPEVINSKQMHETMSRRKKQPNESFYQYMLVMKELGKRAKFPDYVAIQYIIDGISDYESNKLLLYGVTSYSVLKEKLVLYESFKEKSKKSVDTMRRGQRDTAVMPRQIHRCYNCGERGHLSSSCRRGIKCFKCNGFGHKGTECRASQGMEAKKASNNYYGGGDEQDRRSMFVRQQEDDEKNENELYEREQCDLKEQVSDMPNFSCQQLNHIVSSNLLNVNKRDSINMSVKSVKVGNYVTNCLIDTGSDLNLITFDLFTKLKCEYIPEKMLLTGLGSSKVYSIGKFDTDLTIDSHRYSINLYIVPTGGIPYDVILGQQFLVNTITVIDRGLVEVRPTCYDISYQNAICLSSSSDDRCTAVREIIDSYTPLKTKDAPIRLKIVLKDDVPVSQRPRRLAITEEQLVKQHVDALSRNILFVDVELHARVKKAQADDESLKVIRKILEENEYEDYFLENGVIYKGIEKKLVLPKILDMEIIKKAHCTGHFGKKKIRDIIEKDYFITKLDSKIEKVISTCVPCLLASRKSGKKEGLLNPIEKGELPLDTLHCDHLGPLDATKKMYNYILTIIDGFTKFVWIYPVKTVTAKETVEKLRLHQKDFGNPRRIITDRGTAFTGSEFREYCEEEDIEHVTITTGIPRGNGQVERMNSIIISALTKMCIEEPGHWYKYTSKLQQVINSTYQRAICTTPFELLTGVKLKLKEDLSILEYLEEENRLQFMNRREEARREAKAQILRMQEENRKTYNKRRKVGEMYKVGDLVAIQRTQFGNALKLKPKFYGPYRITREMGKGRYEVEKIDRSKDGPVRTTSALDFMKRWP

Summary

Uniprot
ProteinModelPortal
PDB
3S3N     E-value=8.4114e-29,     Score=320

Ontologies

Topology

Length:
887
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06486
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00042
outside
1  -  887
 
 

Population Genetic Test Statistics

Pi
211.135441
Theta
132.105939
Tajima's D
1.484178
CLR
11.870686
CSRT
0.785910704464777
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号