SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05419
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.113
 

Sequence

CDS
ATGGCGGACGACGCTTCAAGAAAATTACTTCCAGAGTTTACTGGAACTAATTTCAGCACGTGGATATTTCGAATATCATGCATCCTAGAGGAAAAGGAATGCAAAGAAGCAATTGAAGATGGCATAACAGAGGAAATATTGAAGTCGGAAAAATTCAAAAAGAAAGACGCAAAAGCTAGAAGTTTGATAGTCAACTGCCTCTCAGACAAACACTTGGAATACGTCAGAAGCGCTACGAGTGCAAAAGAGATGATCGAAAACTTACGAAAAATATTCAAAAGAAAAAGTACGTTATCTGCGTTATACGTCAGGAAGAAATTATTAACCTTAAAATGTGACCCCAGTGTCGAACTGAGCGACCACTTCAACAATTTTGATATGTTAATAAGACAATTAGAAGAAACTGGAAGCACAGTAAATGAACAAGACAAGGTGTGCCACTTACTACTGACTATGCCTGACAGCTACAATACTACAATTGCCGCCTTAGAAACTACGAATGTGGAACTTACAACAGAGTATGTCAAAAGCAAATTGTTAGATGCAGAACTAAAAAACCAAAATAATTCAATGGAATCACAGGATGCACACAGCTTCCTCAGTTGCTTTAAATGTGGTAAAACTGGTCACAAAGCTATACAGTGCAGAACTGGACACTTAATGAGAGGACAGCATCGAGGCAAAATGGGCAACGTCGGATATTTCAACGGAAGTAACACTAGAGACTTCTATCGAGGCAACGGCAGAGACTTCAATCCAGGTAACGGCAGAGGCTTTAACCGAAGCAATCCCAGAGGCAACGTGAGAGGACAATCGAGGGGATCATCAAGGGACACCATACTCCAACAAGGAAAAAGTGCTTTAAGTGAGAGAAATCCATTTTCTTTTGTTGCCAGTGAAAAGATGCTATCTGTTGATGTGTATAATGAGGACATTAAGTTTATTATTGATTCAGGAGCATCTCAAAATTTAGTCATTGATAGTTATGAAAAGTACATGTCAAACATTGAATATTTAGAAACTAAAACTAAGATTTATGTTGCTAATGGTCAATATTTGTTTTCAAGTAAAAAAGGGATTTTAAATGTAAAATATAATAACTTACCTATTAAAATAGAAGCACTACTTGTCAAGGGGCTATCCCACAACTTATTATCTGTTAAAAAAATATTAGAGAAAGGAAATTCTGTCAGATTTCATAAAAATTCTGTATCAATTGCTAAAGGAAATAACATAATTTATGGTACCATGCTTAATAGTCTGTATGCAATCAATCTAACATTAAACTTAGAAAAATGTTATTCGATAAATAATGATAAAGATCTATGGCATAAAAGGTTAGGACATGCTAATAGAAAACACTTAAAGTTATTGAAATTACCTATCTCAGAAAAACCATGTGGAATATGTGTAGAAGGAAAATCAACAAGATTACCATTCTCTACAACACCCAAGCCGAGATCAAAGTATATAGGAGAACTCATACACACAGATATATCAGGACCAATAAATATTCCTACACTTACAAATGAGGTATATTTTCATACAATTATAGATGATTACACACATTTCTGTGAGGTATACTTATTACAAAGAAAAAGTGAGGCAACGGATAGGCTTATAGAATATGTTAATAGAATGGAAAGACAAATAGAATGTAAAGTCAAGAAAATCAGAAGTGATAATGGTGGTGAGTTTAAAAATGAAAAACTAAATAAATTTTGCAAAGATAAGGGAATTGTTCAACAGTTTACTTTGCCTTATAGCCCACAGTCAAACGGAGTTTCAGAACGCATGAACAGAAATATTTATAACAGAGCTCGGACTTTATTAATTGAATCTGGTTTACCAAAAACCTTATGGGGTGAAGCGGTGCGATGTGCTGTCTATCAAACCAACAGATGTCCATCGTCTGCTATAAACTTTCAAACCCCAGCAGAGAAAATGTTTGGAAACAAAGACTTAACAAGACTTAGGATATTTGGATCAAAATCATGGGTTCACATCATACCAAAACAAGATAAACTTTTACAAAGAGCTAAAGAAATGAGACTCGTAGGATATAGCCCAAATGGATATCGTCTATGGGACCCTACAAGTAATAAAGTGATAGTGTCAAGAGATGTCAGAATTGATGAAACTCAATTAAACTACAAGGAAACTGAAGAAAAGCATAACATAAAAGGAGAAACATACTATGAAGATGAATTAATACAAAATGACGATACTGAGAAGGACACAGAAGCTGACCAAGAGACAAGAATACCTAATGAAAATGATGAAAACATGCAACATGATAGAATACCTGATAAATCAAATAAAGAAGTATCAAAGAATAATCAAGATGATGAAGAAGAAAATGAAAAATTGAATAAAAAAGGTAGAATAAATATACAGAAATATATAACAAGATCAGGAAGAGAAATTCGCAAACCAAAAAACTTAGAAGAATATGATCTAAATATAGCATACTGTCTTTTATCGGGAGATCCACAAGAATTTGAAGATGCAATTCATGACAAAGACTGGGAAAAAGCAATAAAGACAGAATTAAATTCACAAGTGAAATTAGAGACATGGGAAGAAGCTACATTACCAATGGGAAGTAAAGCAATAGACACAAAATGGGTATTCCGAACAAAACAAAATGGAACCAAGAGAGCTCGATTAGTAGCGAAAGGTTTTCAGCAACAGAACAATGATAATCATTATGCTCCGGTAGCCAAATTGTCAACTATCAGATTAATGATGAGTTTAGCAGTTCAACTGGATTTGTCATTAAAGCAATTGGACGTACCAACAGCCTTCTTAAATGGAAAGTTAAACGACAATGTCTATATAAAATGTCCCAAAGGAATGGAAATTAGTGAAGGAAAAGTTTTAAAACTTAAAAGGGCTTTGTATGGATTAAAAGAAGCACCTAAATGCTGGAACCAAAGATTTCATAATTTTGTCACTCAGAAAGGGTTTGTACAATCACAGCATGATTTATGTTTATATGGAAAAGGAAAAATTTGGATATTACTTTATGTGGATGATATTTTATACCTTGGAAATAGCAATGAGATGATAAAGGAATTAGAAAAGGAATTTAAAGTAAAAAACTTAGGAGAAGTACATCAATATTTAGGATTGGAAGTAACAAGAACAGAAGACAGCTTGGAAATAAGACAAACAGAAATAATTAAAAGACTTCTGGAGAAATATCACATGCAAGATTGCAAATCAAGCAAGACTCCAATGGAAATTAATTTTAATGTAAACATTCCATCACCATCAGATATAATTGAAGTACCCTTCAAGGAATTAATAGGATCTTTGTTGTACATTGCTGTGAATAGTCGACCGGATATTGCTTATGCTGTATCATTCTTAAGCAGATTCTTAGATAAACCCACACAAGAATTATGGACAGCAAGTAAGAGAGTGTTACGTTATCTGAAAGGAACCTCTCATCAGGGACTGATTTATAGGAAGACTGAAGAGTACACAAAACTTATAGCCTACTCAGACGCTGACTGGGCAGCAGATAGAACAGACCGTAAGAGCACAAGTGGCTGTGCCATATATCAAGGCCAGAACTTAATAACTTGGTTCTCTAGAAAGCAAACATGTACAGCTCTGTCAACAGCTGAAGCTGAGTATGTGGCTGGAGCACACTCAATGAGTGAACTTATTCACATCAAAGGAATACTTTCTGACATATTAAGTACTAGTATCATTTCAGCTCATTTATTGATTGACAATCAGAGTACAATAAAATTGATACAAAATCAGATGAATACTAAAGCTTCTAAACATATTGAAATAAAATATCACTACATTAAAGATTTAATTTATAAGAAAATAGTGTCAATCTCATATGTGCCTACAAATGAAAATATCTCTGATATATTTACAAAATCTTTAACTATTCAAAAACATAATTATTTTTGTAGCAAGTTGAATTTAGTTTAA
Protein
MADDASRKLLPEFTGTNFSTWIFRISCILEEKECKEAIEDGITEEILKSEKFKKKDAKARSLIVNCLSDKHLEYVRSATSAKEMIENLRKIFKRKSTLSALYVRKKLLTLKCDPSVELSDHFNNFDMLIRQLEETGSTVNEQDKVCHLLLTMPDSYNTTIAALETTNVELTTEYVKSKLLDAELKNQNNSMESQDAHSFLSCFKCGKTGHKAIQCRTGHLMRGQHRGKMGNVGYFNGSNTRDFYRGNGRDFNPGNGRGFNRSNPRGNVRGQSRGSSRDTILQQGKSALSERNPFSFVASEKMLSVDVYNEDIKFIIDSGASQNLVIDSYEKYMSNIEYLETKTKIYVANGQYLFSSKKGILNVKYNNLPIKIEALLVKGLSHNLLSVKKILEKGNSVRFHKNSVSIAKGNNIIYGTMLNSLYAINLTLNLEKCYSINNDKDLWHKRLGHANRKHLKLLKLPISEKPCGICVEGKSTRLPFSTTPKPRSKYIGELIHTDISGPINIPTLTNEVYFHTIIDDYTHFCEVYLLQRKSEATDRLIEYVNRMERQIECKVKKIRSDNGGEFKNEKLNKFCKDKGIVQQFTLPYSPQSNGVSERMNRNIYNRARTLLIESGLPKTLWGEAVRCAVYQTNRCPSSAINFQTPAEKMFGNKDLTRLRIFGSKSWVHIIPKQDKLLQRAKEMRLVGYSPNGYRLWDPTSNKVIVSRDVRIDETQLNYKETEEKHNIKGETYYEDELIQNDDTEKDTEADQETRIPNENDENMQHDRIPDKSNKEVSKNNQDDEEENEKLNKKGRINIQKYITRSGREIRKPKNLEEYDLNIAYCLLSGDPQEFEDAIHDKDWEKAIKTELNSQVKLETWEEATLPMGSKAIDTKWVFRTKQNGTKRARLVAKGFQQQNNDNHYAPVAKLSTIRLMMSLAVQLDLSLKQLDVPTAFLNGKLNDNVYIKCPKGMEISEGKVLKLKRALYGLKEAPKCWNQRFHNFVTQKGFVQSQHDLCLYGKGKIWILLYVDDILYLGNSNEMIKELEKEFKVKNLGEVHQYLGLEVTRTEDSLEIRQTEIIKRLLEKYHMQDCKSSKTPMEINFNVNIPSPSDIIEVPFKELIGSLLYIAVNSRPDIAYAVSFLSRFLDKPTQELWTASKRVLRYLKGTSHQGLIYRKTEEYTKLIAYSDADWAADRTDRKSTSGCAIYQGQNLITWFSRKQTCTALSTAEAEYVAGAHSMSELIHIKGILSDILSTSIISAHLLIDNQSTIKLIQNQMNTKASKHIEIKYHYIKDLIYKKIVSISYVPTNENISDIFTKSLTIQKHNYFCSKLNLV

Summary

EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GDHC01007058    JAQ11571.1    LBMM01007046    KMQ90088.1    ABLF02041793    JXUM01085595    KQ563513    KXJ73717.1    GEHC01000928    JAV46717.1    GAKP01015342    JAC43610.1    GDHF01032610    GDHF01032500    JAI19704.1    JAI19814.1    LBMM01012492    KMQ86193.1    GFTR01008662    JAW07764.1    GDHF01010549    JAI41765.1    KQ483702    KYP42748.1    GDHF01021893    JAI30421.1    GDUN01000694    JAN95225.1    KQ483417    KYP53032.1    FJ544851    ACL97383.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    OIVN01002055    SPD00174.1    GEZM01032204    JAV84770.1    FJ544856    ACL97386.1    FJ544853    ACL97384.1    FJ544854    ACL97385.1    OIVN01006211    SPD27863.1    KQ484186    KYP36645.1    CM003607    KYP67664.1    GBHO01002761    JAG40843.1    OIVN01002473    SPD03944.1    CM003612    KYP59064.1    GEHC01000966    JAV46679.1    FJ225394    FJ225395    ACN78973.1    OIVN01002516    SPD04274.1    OIVN01006261    SPD29147.1    GDUN01000215    JAN95704.1    GDUN01000217    JAN95702.1    OIVN01003683    SPD12935.1    GBHO01024362    JAG19242.1    GAKP01010102    JAC48850.1    GEHC01000879    JAV46766.1    GGFL01004951    MBW69129.1    GEHC01000959    JAV46686.1    OIVN01006387    SPD32065.1    GGFM01000952    MBW21703.1    GGFM01000953    MBW21704.1    OIVN01001931    SPC99063.1    CM007892    OTG31811.1    LBMM01012772    KMQ86003.1    PDCK01000039    PRQ60431.1    CM003608    KYP66486.1    CM007893    OTG30017.1    CM007895    OTG22666.1    JYDP01000258    KRZ01816.1    GBXI01007143    JAD07149.1    GDHF01006360    JAI45954.1    KQ459603    KPI92981.1    HG001843    CDF77535.1    D83003    BAA11674.1    KQ461175    KPJ07802.1    GECL01003258    JAP02866.1    GECZ01025604    JAS44165.1    JYDJ01000136    KRX42725.1    OIVN01006466    SPD33659.1    GEDC01029908    JAS07390.1    GEZM01063091    JAV69316.1    AB005236    BAB09923.1    OIVN01001308    SPC92446.1    AC006248    AAD17409.1    JYDN01000113    KRX56900.1    NKQK01000002    PSS35035.1    GFTR01008327    JAW08099.1    OIVN01004651    SPD18552.1    JYDH01000330    KRY26802.1    GDHF01000873    JAI51441.1    OIVN01001906    SPC98838.1    OIVN01006353    SPD31284.1    OIVN01000486    SPC81000.1    JYDP01000350    KRZ01021.1    AC007662    AAD32759.1    JYDM01000185    KRZ84108.1    AL138657    CAB75481.1    KRY26801.1    GEVI01026597    GEVI01022915    JAU05723.1    JAU09405.1    JXUM01046915    KQ561496    KXJ78389.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    GDUN01000695    JAN95224.1    KQ460297    KPJ16236.1    GBHO01016859    JAG26745.1    GBHO01043059    JAG00545.1    JYDJ01000518    KRX34768.1    ASHM01023047    PNX71231.1    OIVN01000557    SPC82046.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF08534   Redoxin
PF00106   adh_short
PF00626   Gelsolin
PF08033   Sec23_BS
PF04500   FLYWCH
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
IPR007123   Gelsolin-like_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR036180   Gelsolin-like_dom_sf       
IPR012990   Sec23_24_beta_S       
IPR011009   Kinase-like_dom_sf       
IPR007588   Znf_FLYWCH       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF51735   SSF51735       
SSF52833   SSF52833       
SSF82754   SSF82754       
SSF56112   SSF56112       
SSF50630   SSF50630       
Gene 3D
PDB
5UOQ     E-value=6.1257e-08,     Score=141

Ontologies

Topology

Length:
1318
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0580700000000001
Exp number, first 60 AAs:
0.00128
Total prob of N-in:
0.00021
outside
1  -  1318
 
 

Population Genetic Test Statistics

Pi
536.585997
Theta
222.671664
Tajima's D
4.439242
CLR
0.712418
CSRT
0.999850007499625
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号