SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05414
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.131 Nuclear   Reliability : 1.398
 

Sequence

CDS
ATGATGGCAAACTTCAAACAAAAATTACCCCAGGAGGGTACCACCTTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCACGCTGCCCCGCGTATTCTGGGGGGGGCAAAGAATGCCAAGATGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGCCAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGACGGCGAGGCAGTTGATCCAAAAGGGACAACCGCCAAGAAGATCAGGCGGAAGAGGAAGTCGTGGCGAGTTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCGTCCTCTGGTGCGGATGCCCCACCGGAGAAAGTGCTGGTAGTCTCCGAAGCGGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAAAGGGAGACCCGCCCGTAGAAGAGGCGCACCGTCACCGGCACCATCATCAGTGTCGATGTCTGTCGCCTCACTAGACGGGCAGACGACGGAGGAGGAAGAGGGTGGTCTTCAGGACCCTGCCTTGGTCATAGACAGGGCCATGAAGACCATCAAATCATATGCGGCCAACGGCACCAAAACCAAAGCTGCTGGCCGAAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAGGTTCTGCCTTCGGTTGCTTCTGCCAATGACCAGGTAGTACAGCTGATGGCGGAAAATTCGAGGCTTCGAGCACAGCTTCAAGCACAGCAGCAACCCAATGACGGCGCAGCGACGCCTTGGGCTACTGGAGCCCCTCGGGGCCCCCGTCCCCCGGCGCTGACTGGCGACCGATGGCCTGTGCTGCCACCACCGCGTGTGGCACAACAGCGGCCGCGTCTCCCGTCACCGCGCTCTAGGGAGACGTCCGCCGCCGAGCGACGGCGGACACTCGCGGGGCCACGGATGTTGGCTCCGCCAGAACCAGCAAACTTCAGCCTGGACGAGGTCATCAGCCGCACTGTCCAGGCTGTAATAGAAAGGCTGGGCGGCAGGTTGGCAGCTCTCGAGGCGAAAGTCTCGGTCTCGGCTGACACTAGGCGGCCGGCGGTGTCGGGTGCTTTGGCCACTCGTCCTGCTCCCGTACGAGCTCCGGCCACCAAGTCGGGCCCGGGACGGGCTAAAACCAAGCGAGGGGGTGGCGCTATAGCGAATCCTCCACTACAAGCACCCCAGTCCCGTCCACTGCCTCCGCCTCCGTCAAATATGGACGAGGGGTGGAACGTGGTGGCCAGGCGGGGCACCAGAAAGGCCCCACCGGCAGCTCCTCAAATGGGTAGAGCGCCGGCGGCCAAGGCGGCTCAAGCTGCACCCCAACAGGGTCGAGCGTCTGAAGCCGCCAAGAAAAACCAAAAAAAGAAGTTACCGCGCGCGCCTCGGTCGGCAGCAGTGGTTCTTACCCTACTGCCAGCCGCTGAAGCCAAGGGCATGACATACAGAGATGTCATCGCCCGGGCGCGTGCGGCAGTTGACCTGGGCGAGATTGGGGCGGAGGAGGGCCTCCGCTGCAGGCAGACGGCCAACGGGGCCAAGCTGCTAGAATGTCCCGTTGCCGATAGTGCCGGCATCGCGGAGCGTCTGGTGGCGAAGCTCCGTATGGTCCTACCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTGAAAATGGCCGAATTAAGAGTAACCGGCCTGGACGACTGTACCACCAGGGATGAGGTGATGGCGGCTGTCGCTGTCCAGGGCAAATGCGCACTGGAAAATGTAACCGTAGGCGAGCCGCGCCGCGGTTATACCGGGGCCAGCTCGGTGTGGGTGCGTTGCCCGGTGGAGGCGGCTGCCTCCCTGGCTGCTCCCCCGCCCGGGAGACCATCAGGAAATCCAGGCATACTGCGCGTGGGCTGGATAGCGGCCCACGTACGCTTGCTTGAGTCACGCGCCTGGCGATGCCTTCGGTGCTTTAGCACTGGACATGGCTTCGCCAGGTGCACCAGCTCGGTTGACCGCAGCGGTCTATGTTTCCGCTGCGGCCAACCTGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGTAGGGCAAACCACCGGGCGGGAGGCAAGGCTTGCTTCCCGTCCGGTGTTAATACTGAACGCAACCGGCGCCGAAAATCAAGGCGCCGGCAGAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAATGTTGCAATCCCCGCTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGTGGAGTGGTCCATAGACGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGACGATCCCCCCCTTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACTGTCGAGTTCGGGCATTTCCTGGACGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTGTTGGAGAGGTGGGCGAACGTGGCCGGCCTCTATTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATTCGCGACTGGAGGGTTCTGGAGGGGGCGGAGACGCTGTCAGATCACCGGTATATTCGATTTGATCTCTCCGCCCGCTCCACAGTCGCGGTCGCCTACGGGGACCACCCCCGTGGTGCATCCCGGTCATTCCCCAGGTGGGCACTGAAGCGCTTGAATAAGGCGCTACTGATGGAAGCTTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACATCCAGTTGAGGTCGAGGACGAAGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGACGTGTCGATGCCCCGGATTAGCCCTCGACCTCCCAATCGCCAAGTGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGTGTGGAGTGCGTTCGGGCGAGGCGCCAGTGTGCGAGGCATCGCCGCCGTCGCCTGCCGCGGCGCAACGATCCGGTGGCGTTCGCGGTGGTAGAGGCCCAGCTGTACGGCGCATTTCGCGTCGCACAGAGGGCGTTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCACATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCAGGGGGGATTTGTCGCTCCCGCTATGGGCGCGCCGCCGGAATACGACGGCGACGCCCCTGCTGAGGTGCCCCATATAACAGGGGCGGAGCTCCGTGTGGCAGTACGCAAAATGTGCGCAAAGGACACTGCACCTGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAACTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGCTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTGCGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTGCATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATCTGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCATTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGGTCAATGGCCTTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGGGTGTTACCATTGTGGTTGCGACTTGGATACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCGAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMANFKQKLPQEGTTLGGESLRASTSVGARCPAYSGGGKECQDEGGCATGSGKPVEPRCASAGSTRSALVSDGEAVDPKGTTAKKIRRKRKSWRVSSREGVGEPASSSGADAPPEKVLVVSEAASAAEEMPPPKGRPARRRGAPSPAPSSVSMSVASLDGQTTEEEEGGLQDPALVIDRAMKTIKSYAANGTKTKAAGRKLREVVSQVSKVLPSVASANDQVVQLMAENSRLRAQLQAQQQPNDGAATPWATGAPRGPRPPALTGDRWPVLPPPRVAQQRPRLPSPRSRETSAAERRRTLAGPRMLAPPEPANFSLDEVISRTVQAVIERLGGRLAALEAKVSVSADTRRPAVSGALATRPAPVRAPATKSGPGRAKTKRGGGAIANPPLQAPQSRPLPPPPSNMDEGWNVVARRGTRKAPPAAPQMGRAPAAKAAQAAPQQGRASEAAKKNQKKKLPRAPRSAAVVLTLLPAAEAKGMTYRDVIARARAAVDLGEIGAEEGLRCRQTANGAKLLECPVADSAGIAERLVAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVMAAVAVQGKCALENVTVGEPRRGYTGASSVWVRCPVEAAASLAAPPPGRPSGNPGILRVGWIAAHVRLLESRAWRCLRCFSTGHGFARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGVNTERNRRRKSRRRQKRRLARGALANVAIPAAAPVPEGGGSGNLNHSARAQDMLSQSMVEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDATIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLDGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANVAGLYLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSTVAVAYGDHPRGASRSFPRWALKRLNKALLMEASTVAAWAPMRPHPVEVEDEAGWFRDTMRRICDVSMPRISPRPPNRQVYWWSPEIAQLRVECVRARRQCARHRRRRLPRRNDPVAFAVVEAQLYGAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEQGGFVAPAMGAPPEYDGDAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLLGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAGCYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=8.09465e-12,     Score=176

Ontologies

Topology

Length:
1800
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14664
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1800
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
65.610923
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号