SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05409
Pre Gene Modal
BGIBMGA000889
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.806 PlasmaMembrane   Reliability : 1.583
 

Sequence

CDS
ATGAGCTGTGATTACGGATATGTGCGCCTATCCAGTACATTTCTGTTACGTAGGAGTCCTGCAATTCTGTTTGAAGGTGTGGTGGTGGCTATCATACAACACAAGATATTTGACAGATGCCTGAATCTCGCTTCCGACATTTTCAAGATAAGCTTGCATATATACAAGTTCCGAACAACATTCGGACCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGACAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCACCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAATAGGCGGAAACCCATCCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGCGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGGCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAACACCTCCGCCCCCGTCACTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCTGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCGACATTAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCATGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCATTCCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGTGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACATAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MSCDYGYVRLSSTFLLRRSPAILFEGVVVAIIQHKIFDRCLNLASDIFKISLHIYKFRTTFGPGKPKNETASYRPISLLPAIDKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTSAPVTRPITMFDQPIPWALKVKYLGVTLDSRMTFRPDIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYACVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMCHFDKAARHENPLIVAAGNYIPDPADIMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    KQ459580    KPI99178.1    AF081101    AAC72919.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    GGMS01004685    MBY73888.1    ABLF02014862    ABLF02014866    ABLF02061908    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    ABLF02042518    ABLF02057746    ABLF02008933    KQ973342    KXZ75569.1    KK117880    KFM71667.1    GALX01005300    JAB63166.1    GFTR01008038    JAW08388.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    KK113014    KFM59099.1    ABLF02033757    NEVH01012084    PNF30905.1    NEVH01000598    PNF43535.1    GGMR01016114    MBY28733.1    RPOV01000134    RPJ78669.1    GEZM01038405    JAV81653.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    GGMS01000737    MBY69940.1    GGMR01003407    MBY16026.1    JRES01000644    KNC29657.1    GGMR01018716    MBY31335.1    NWSH01000032    PCG80497.1    JXUM01155316    KQ572171    KXJ68070.1    GEZM01053022    JAV74219.1    GGMS01008766    MBY77969.1    NEVH01006736    PNF36716.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    GFXV01006424    MBW18229.1    NEVH01006721    PNF37225.1    NEVH01026386    PNF14434.1    S59870    AAB26437.2    NEVH01007578    PNF35646.1    NEVH01005938    PNF38077.1    LBMM01010106    KMQ87671.1    NEVH01001355    PNF42855.1    NEVH01010546    PNF32261.1    NEVH01020963    PNF20308.1    GFXV01000774    MBW12579.1    NEVH01003017    PNF40781.1    GGMR01000676    MBY13295.1    NEVH01007443    PNF35684.1    NEVH01023962    PNF17612.1    PCG80496.1    NEVH01012089    PNF30491.1    NEVH01007393    PNF35987.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    GGMS01004444    MBY73647.1    NEVH01000280    PNF43672.1    NEVH01020071    PNF21969.1    ABLF02019349    ABLF02041900    GGFJ01001858    MBW50999.1    AF012049    AAC24972.1    GBBI01001693    JAC17019.1    NEVH01019964    PNF22161.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    NEVH01023961    PNF17613.1    GEDC01000337    JAS36961.1    ABLF02066620    NEVH01014858    PNF27387.1    NEVH01007841    PNF34974.1    NEVH01002716    PNF41415.1    GFTR01008279    JAW08147.1    NEVH01016302    PNF25823.1    GGFJ01001857    MBW50998.1    NEVH01011985    PNF31054.1    GGMS01012005    MBY81208.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GGMS01002992    MBY72195.1    NEVH01026154    PNF14491.1    ABLF02024246    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GEDC01015644    JAS21654.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    NEVH01020940    PNF20481.1    GBBI01001646    JAC17066.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF10551   MULE
PF07530   PRE_C2HC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR018289   MULE_transposase_dom       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.0006208,     Score=103

Ontologies

Topology

Length:
512
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.81277
Exp number, first 60 AAs:
0.7612
Total prob of N-in:
0.05729
outside
1  -  512
 
 

Population Genetic Test Statistics

Pi
2.620566
Theta
4.942151
Tajima's D
-1.373888
CLR
1830.391832
CSRT
0.0699465026748663
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号