SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05381
Pre Gene Modal
BGIBMGA007053
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.995
 

Sequence

CDS
ATGCATAGTCCATGTGCAGATTGTGGCAGTGACCACCAACTACTTGTTGCAAAAGTTAAAATCCGTCTTAAGTCAATCAAACAGCAGAAACCCAGGAAGGTGGTGGACATATCGGGTCGAGCGCAGGAGTTGTTTGCCAATGCCATTAAGGAGCGGTTGCGTGATTTTGCCGTAGATCCCTTCGACTCTGCAAATGTTACCTGGGAACAGTTGAAACAGGTAACCTTGCAGACAGCGAGCGAAGTCGTCGGAACACAAGCAATAGAACAACCTAAATCACCTTGGATGTCCGAAGAAACATGGTCAGCTATCGTCAGAAGAAAAGCCCGAAAGGAGGATGGTCTTACGACTGACGCAGATAAGCATGAGTACAGACTGCTGCATCATGAAGTCCAAAGACTTTGCAGACGTGACAGAGATGCCTATATAAGTGCTGTCTGCGACGACATTCAAAGGGATTCTGAACGCATGCATTCTAAGGACATGTTCCGCAGAGTGAAGCTGTTGGCCAAAGAGTACAAGCTGAAAACCTGGACTATTGAGGACGACCGTGGTAACCTCATCATTGACAGGCAGGCTGCGCTAGACAGATGGAGGAGATACAGCGAACAGCTATATTGCGAAAAGGGCTGCAATGATATTGAAGGAAGGGTGGACTATAACCAACATGAGCCAGATATCCTTCTTCAAGAAGTTGAGGCAGCAATCAATAGGCTGAAGCAAAAAGCATGCGGAAGGGACAGCATAACTTGA
Protein
MHSPCADCGSDHQLLVAKVKIRLKSIKQQKPRKVVDISGRAQELFANAIKERLRDFAVDPFDSANVTWEQLKQVTLQTASEVVGTQAIEQPKSPWMSEETWSAIVRRKARKEDGLTTDADKHEYRLLHHEVQRLCRRDRDAYISAVCDDIQRDSERMHSKDMFRRVKLLAKEYKLKTWTIEDDRGNLIIDRQAALDRWRRYSEQLYCEKGCNDIEGRVDYNQHEPDILLQEVEAAINRLKQKACGRDSIT

Summary

EMBL
FJ265559    ADI61827.1    BABH01014646    BABH01014647    BABH01034460    BABH01034461    + More
BABH01034462    GU815090    ADF18553.1    KZ150203    PZC72267.1    FJ265557    ADI61825.1    FJ265553    ADI61821.1    FJ265548    ADI61816.1    KZ150025    PZC74827.1    FJ265546    ADI61814.1    LBMM01000801    KMQ97461.1    KZ150087    PZC73751.1    LBMM01007694    KMQ89503.1    ODYU01006118    SOQ47682.1    MRZV01001667    PIK36482.1    FJ265560    ADI61828.1    NWSH01000575    PCG75551.1    AHAT01015780    NCKU01004395    RWS06003.1    FJ265547    ADI61815.1    FJ265552    ADI61820.1    GBBM01003639    JAC31779.1    JTDY01003694    KOB69135.1    NWSH01000469    PCG76200.1    BABH01034706    GBBM01006247    JAC29171.1    ODYU01000634    SOQ35746.1    MRZV01001216    PIK39651.1    AHAT01016400    NEVH01003750    PNF40086.1    KL367526    KFD66335.1    KN538403    KHJ42451.1    QIAP01000240    PYX61602.1    NEVH01006736    PNF36722.1    KF881087    AIJ27486.1    GGMR01006433    MBY19052.1    NEVH01017533    PNF24153.1    NEVH01016127    PNF26367.1    NEVH01002700    PNF41535.1    NEVH01007824    PNF35184.1    NEVH01015305    PNF27148.1    NEVH01026403    PNF14170.1    NEVH01012087    PNF30599.1    NEVH01018380    PNF23492.1    NEVH01020868    PNF20797.1    NEVH01021610    PNF19569.1    NEVH01013243    PNF29503.1    NEVH01025668    PNF15041.1    NEVH01017443    PNF24485.1    NEVH01021928    PNF19298.1    NEVH01023960    PNF17698.1    NEVH01021931    PNF19256.1    NEVH01017452    PNF24293.1    NEVH01016289    PNF26277.1    NEVH01019064    PNF23230.1    NEVH01025130    PNF15934.1    NEVH01017460    PNF24248.1    NEVH01020865    PNF20863.1    NEVH01015309    PNF27009.1    NEVH01014359    PNF27789.1    NEVH01007402    PNF35815.1    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01025135    PNF15828.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    PNF40091.1    NEVH01002982    PNF41147.1    PNF27813.1    NEVH01013215    PNF29703.1    NEVH01021921    PNF19488.1    NEVH01013275    PNF29009.1    NEVH01013553    PNF28765.1    NEVH01019971    PNF22037.1    NEVH01027104    PNF13657.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002138   Pept_C14_p10       
IPR027124   Swc5/CFDP2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
250
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04136
outside
1  -  250
 
 

Population Genetic Test Statistics

Pi
303.321739
Theta
209.103173
Tajima's D
3.720234
CLR
23.248347
CSRT
0.9966001699915
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号