SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05379
Pre Gene Modal
BGIBMGA004679
Annotation
putative_transposase_yabusame-1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.801
 

Sequence

CDS
ATGGATATTGAAAGACAAGAAGAGCGAATCCGTGCCATGTTAGAGGAGGAGCTAAGTGATTATTCTGATGAATCCAGTTCAGAAGATGAAACCGATCACTGTAGTGAGCACGAAGTGAATTATGACACAGAAGAAGAGCGGATAGATTCAGTTGATGTTCCATCCAACTCCAGGCAGGAAGAAGCAAATGCAATAATAGCAAACGAATCAGATAGTGACCCCGATGACGATTTACCATTGTCTCTCGTCAGGCAGAGAGCTTCAGCTTCTCGACAAGTGAGTGGCCCTTTTTATACGTCAAAAGACGGTACCAAGTGGTATAAAAATTGTCAACGTCCAAACGTAAGGCTTCGTTCCGAAAACATCGTAACAGAGCAAGCTCAAGTAAAAAATATTGCAAGGGATGCTTCTACAGAGTATGAATGCTGGAATATTTTTGTCACTTCAGATATGCTACAAGAAATTTTGACCCACACTAATTCGTCAATTCGCCATAGACAAACCAAAACTGCTGCTGAAAATTCGAGTGCTGAAACTTCTTTCTACATGCAAGAAACCACATTATGTGAATTGAAAGCATTAATTGCATTATTGTACTTAGCTGGCCTTATCAAATCTAATCGACAGAGTTTGAAAGATCTTTGGCGAACCGATGGAACTGGCGTTGATATATTTCGCACCACAATGTCACTCCAGAGATTTCAGTTTCTGCAAAATAATATTCGTTTTGATGACAAATCTACGAGAGATGAGCGTAAACAAACTGATAATATGGCTGCCTTCAGAAGCATTTTTGACCAGTTTGTTCAATGCTGTCAGAATGCGTACTCCCCAAGTGAGTTTCTGACTATCGATGAGATGCTACTATCATTTAGAGGTCGATGCCTGTTTCGTGTCTACATTCCAAATAAACCAGCCAAGTACGGTATAAAAATTTTGGCTCTAGTCGATGCAAAAAACTTTTATGTCGTGAATTTGGAAGTGTACGCAGGAAAACAACCGTCGGGACCATATGCAGTTAGTAATAGACCCTTTGAAGTAGTGGAGAGACTCATTCAACCAGTTGCACGATCACATCGCAACGTGACATTCGATAATTGGTTCACCGGATATGAGCTAATGCTGCATCTACTAAATGAGTATCGACTCACGTCGGTTGGAACTGTACGAAAAAACAAGAGACAGATTCCCGAATCTTTCATTAGAACTGACAGACAACCTAACAGTTCAGTCTTTGGGTTTCAAAAAGATATTACACTCGTTTCCTATGCGCCAAAGAAGAACAAGGTGGTTGTTGTTATGTCCACCATGCATCATGATAACTCAATAGATGAATCTACAGGAGAGAAACAAAAACCTGAAATGATAACATTCTATAATTCGACCAAAGCTGGCGTTGATGTGGTTGATGAGTTGTGTGCCAATTACAACGTTTCTCGCAACAGTAAACGATGGCCTATGACTTTATTCTATGGTGTCTTGAACATGGCAGCTATAAATGCTTGCATTATTTATCGAACAAATAAAAACGTTACGATCAAGAGAACAGAATTCATTCGTAGTTTGGGCTTATCAATGATTTACGAACATCTGCATTCAAGAAATAAAAAGAAAAATATTCCCACCTACCTCCGCCAGCGAATCGAGAAACAGCTAGGTGAACCATCACCAAGACATGTGAATGTACCTGGGCGATATGTCAGATGCCAGGATTGTCCATACAAGAAGGATAGAAAAACCAAGCATTCCTGCAATGCTTGTGCCAAGCCCATATGTATGGAGCACGCAAAATTTCTTTGCGAAAATTGTGCTGAACTCGACAGTAGTCTTTGA
Protein
MDIERQEERIRAMLEEELSDYSDESSSEDETDHCSEHEVNYDTEEERIDSVDVPSNSRQEEANAIIANESDSDPDDDLPLSLVRQRASASRQVSGPFYTSKDGTKWYKNCQRPNVRLRSENIVTEQAQVKNIARDASTEYECWNIFVTSDMLQEILTHTNSSIRHRQTKTAAENSSAETSFYMQETTLCELKALIALLYLAGLIKSNRQSLKDLWRTDGTGVDIFRTTMSLQRFQFLQNNIRFDDKSTRDERKQTDNMAAFRSIFDQFVQCCQNAYSPSEFLTIDEMLLSFRGRCLFRVYIPNKPAKYGIKILALVDAKNFYVVNLEVYAGKQPSGPYAVSNRPFEVVERLIQPVARSHRNVTFDNWFTGYELMLHLLNEYRLTSVGTVRKNKRQIPESFIRTDRQPNSSVFGFQKDITLVSYAPKKNKVVVVMSTMHHDNSIDESTGEKQKPEMITFYNSTKAGVDVVDELCANYNVSRNSKRWPMTLFYGVLNMAAINACIIYRTNKNVTIKRTEFIRSLGLSMIYEHLHSRNKKKNIPTYLRQRIEKQLGEPSPRHVNVPGRYVRCQDCPYKKDRKTKHSCNACAKPICMEHAKFLCENCAELDSSL

Summary

EMBL
AB162707    BAD11135.1    AB159601    BAD07480.1    BABH01039687    AAKN02047000    + More
NWSH01004271    PCG65286.1    ODYU01010244    SOQ55222.1    NWSH01003816    PCG65794.1    ABLF02012085    ABLF02012086    GEDC01031381    JAS05917.1    GECU01006493    JAT01214.1    GEDC01007104    GEDC01004639    JAS30194.1    JAS32659.1    KK112917    KFM58826.1    GEZM01022990    GEZM01022989    JAV88624.1    ABLF02025070    GEDC01013105    JAS24193.1    JYDI01000114    KRY51933.1    GEZM01092454    JAV56552.1    JYDI01000099    KRY52767.1    ABLF02010724    ABLF02014529    GEDC01005015    JAS32283.1    ABLF02061909    ABLF02010723    JYDM01000192    KRZ83916.1    GEBQ01000795    JAT39182.1    KK119053    KFM74523.1    GEBQ01015347    JAT24630.1    ABLF02002291    ABLF02056818    DQ407726    ABD76335.1    GEBQ01029484    JAT10493.1    GEBQ01008003    JAT31974.1    ABLF02003601    ABLF02054890    GU329918    ADU04477.1    GEDC01011391    JAS25907.1    GEBQ01004274    JAT35703.1    GBBI01003661    JAC15051.1    JYDO01000008    KRZ79105.1    GEBQ01006564    JAT33413.1    PYGN01000020    PSN57460.1    JYDW01000090    KRZ56622.1    PYGN01002011    PYGN01000918    PSN31819.1    PSN39358.1    KK119845    KFM76887.1    GEZM01056111    JAV72843.1    GEBQ01012372    JAT27605.1    JYDK01000225    KRX71861.1    KK115134    KFM64244.1    GEDC01025350    JAS11948.1    JYDL01000009    KRX26044.1    GBBI01002117    JAC16595.1    HACA01008647    CDW26008.1    GEBQ01006503    JAT33474.1    ABLF02019776    ABLF02019781    PYGN01000233    PSN50578.1    PYGN01000358    PSN47763.1    ODYU01001398    SOQ37519.1    GBBI01002118    JAC16594.1    NWSH01000300    PCG77621.1    GGMS01014827    MBY84030.1    DS233215    EDS28762.1    KK118795    KFM73858.1    KK115202    KFM64407.1    ABLF02009521    GEBQ01012494    JAT27483.1    ABLF02003596    GDHC01018085    JAQ00544.1    KK854797    PTY18824.1    PYGN01001458    PSN34708.1    QOIP01000004    RLU23313.1    GEDC01029238    JAS08060.1    GEDC01021722    JAS15576.1    GU270322    ADB45159.1    EU287451    ABZ85926.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
PF02944   BESS
PF05485   THAP
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       
IPR004210   BESS_motif       
IPR035896   AN1-like_Znf       
IPR006612   THAP_Znf       
IPR038441   THAP_Znf_sf       
SUPFAM
SSF118310   SSF118310       
Gene 3D

Ontologies

Topology

Length:
610
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.95578
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00574
outside
1  -  610
 
 

Population Genetic Test Statistics

Pi
192.840424
Theta
176.450408
Tajima's D
0.590696
CLR
0
CSRT
0.540972951352432
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号