SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05357  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002539
Annotation
PREDICTED:_V-type_proton_ATPase_116_kDa_subunit_a_isoform_1_[Bombyx_mori]
Full name
V-type proton ATPase subunit a      
Location in the cell
PlasmaMembrane   Reliability : 4.661
 

Sequence

CDS
ATGGGGTCTTTGTTTCGGAGTGAGGAGATGACACTATGTCAGCTTTTCCTGCAAAGTGAAGCTGCTTATGCCTGCGTGTCCGAGCTCGGGGAGTTGGGGCTAGTTCAGTTCCGAGATTTGAATCCTGACGTAAATGCCTTCCAACGTAAGTTCGTCAATGAAGTACGTCGCTGCGATGAGATGGAACGTAAGCTCCGCTACCTGGAGAAGGAGATCAGACGTGACGGCATCCCCATGCTGGAGATCCCCGGAGAGTGTCCCGAAGCGCCTCAACCCAGGGAGATGATCGATCTTGAAGCGACCTTCGAAAAGCTTGAGAATGAGCTGCGAGAGGTTAACCAGAACGCTGAGGCTCTTAAGAGGAACTACCTCGAGTTAACAGAATTAAAACACATTTTGAGGAAGACTCAAGTGTTCTTCGATGAGATGGCGGATCCGTCGAGGGAGGAGGAACAAGTCACCCTACTGGGGGAGGAGGGCCTCATGGCGGGAGGGCAAGCGCTCAAGCTGGGTTTCGTCGCGGGCGTGATTCTGAGGGAGAGAATACCGGCGTTCGAGCGCATGTTGTGGCGGGCCTGCAGGGGAAACGTGTTCCTGAGGCAGGCTGAGATCGACACGCCCCTGGAAGATCCATCATCATCGGATCAGGTTTACAAATCGGTGTTCATCATATTCTTCCAAGGCGACCAGCTGAAGACGCGCGTCAAGAAAATATGCGAAGGTTTCAGGGCGACGCTGTATCCGTGCCCGGAGTCGCCGGCCGACCGCCGGGAGATGGCCATGGGCGTCATGACCAGGATCGAGGATCTGAACACCGTCTTAGGTCAGACCCAGGACCATCGTCACCGCGTGCTGGTCGCCGCCGCCAAGAACATTAAGAACTGGTTCGTGAAAGTGCGCAAGATCAAGGCCATCTACCACACGTTGAATCTGTTCAATCTGGACGTGACCCAGAAGTGCCTCATCGCCGAGTGCTGGGTGCCCGCGCTCGACATGGAGACTATCCAACTGGCTCTGAGGAGAGGAACGGAACGCAGTGGCAGCTCGGTTCCCCCGATCCTCAACCGGATGGAGACTATAGAAGACCCGCCGACGTATAACAGGACCAATAAGTTCACTTCGGCCTTCCAGCACCTCATCTACGCGTACGGCGTGGCCACGTACCGCGAGGTCAACCCGGCACCCTACACGGTCATAACGTTCCCGTTCTTGTTCGCGGTGATGTTCGGCGACCTCGGCCACGGCGCCATCATGGCCGCCTTCGGGTTCTGGATGTGCTACAAGGAGAAGCCGCTGCAGGCCAAGAAAATCGACAGCGAGATCTGGAATATATTCTTCGGCGGTCGCTACATCATCCTGCTCATGGGCCTGTTCTCGATGTACACGGGCCTCATATACAACGACATATTCTCGAAGAGCTTGAACATATTCGGCTCGTCGTGGAGGAACAACTACGACGGCTCCACGCTGCAGAGCAACCAGCTGCTGCAGCTGAACCCCGACTCCAAAGACTACCTGCAGTACCCTTACCCGTTCGGCATCGACCCGGTCTGGCAGCTCGCAGAAGCCAACAAGATTATCTTCATGAACGGTTACAAGATGAAGATTTCTATCATAATAGGTGTCTTCCACATGTTGTTCGGTGTCTGTCTCTCGCTTTGGAATCATTTGTACTTCAAGCGTCGCATCAGCATCTACGTGGAGTTCATCCCCCAGATACTGTTCCTGAGCCTGCTGTTCTTCTACATGGTGCTGCTCATGTTCATCAAGTGGACCACGTACGGCGCCACGCCCGGACACTTCGGCAGCCAGGACCCCGAGATAGTGAAGACGAGCGCGTTCTGCGCCCCGTCCATCCTCATCACGTTCATCAACATGATGCTGTTCAAGCACGACAAGAACACGCGGCCGCAGTGCGACGACTTCATGTTCTCCGGACAGATGTTCATACAGAAGCTGTTCGTGATCGTGGCTCTGCTGTGCGTGCCCATCATGCTGTTCGGGAAGCCGTACTTCATCATGCGCGAGCAGAAGCAGCGCGCCAGACAAGGTCACCAGCCGGTAGAAGGTAACGCCGAGAACGGCACGGCGGGCGGCGCTCCCGTCCCGGCCTCGGGACATCACGACGAAGAGATCACCGAGGTCTTCATTCACCAGGCCATCCACACCATAGAGTTCGTGTTGGGCAGCGTGTCGCACACGGCGTCGTACCTGCGGCTGTGGGCGCTCTCCCTCGCGCACGCGCAGCTCGCTGAGGTCGCCTGGAACATGCTGCTCAGGAAGGGTCTGATGTCCAACGACTACCAGGGCGGGATCTTCCTGTACGTGGTGTTCGCGGGCTGGGCGGCCATCTCCGTCTCCATCCTCGTGCTCATGGAGGGGCTCTCGGCCTTCCTGCACACGCTGCGTCTGCACTGGGTCGAGTTCCAGAGCAAGTTCTACGGAGGAGAAGGCTACCTCTTCCAGCCCTTCTCGTTCGAGATCATTCTAGACTCGGCGGGTCAGGCAGAAGAATAA
Protein
MGSLFRSEEMTLCQLFLQSEAAYACVSELGELGLVQFRDLNPDVNAFQRKFVNEVRRCDEMERKLRYLEKEIRRDGIPMLEIPGECPEAPQPREMIDLEATFEKLENELREVNQNAEALKRNYLELTELKHILRKTQVFFDEMADPSREEEQVTLLGEEGLMAGGQALKLGFVAGVILRERIPAFERMLWRACRGNVFLRQAEIDTPLEDPSSSDQVYKSVFIIFFQGDQLKTRVKKICEGFRATLYPCPESPADRREMAMGVMTRIEDLNTVLGQTQDHRHRVLVAAAKNIKNWFVKVRKIKAIYHTLNLFNLDVTQKCLIAECWVPALDMETIQLALRRGTERSGSSVPPILNRMETIEDPPTYNRTNKFTSAFQHLIYAYGVATYREVNPAPYTVITFPFLFAVMFGDLGHGAIMAAFGFWMCYKEKPLQAKKIDSEIWNIFFGGRYIILLMGLFSMYTGLIYNDIFSKSLNIFGSSWRNNYDGSTLQSNQLLQLNPDSKDYLQYPYPFGIDPVWQLAEANKIIFMNGYKMKISIIIGVFHMLFGVCLSLWNHLYFKRRISIYVEFIPQILFLSLLFFYMVLLMFIKWTTYGATPGHFGSQDPEIVKTSAFCAPSILITFINMMLFKHDKNTRPQCDDFMFSGQMFIQKLFVIVALLCVPIMLFGKPYFIMREQKQRARQGHQPVEGNAENGTAGGAPVPASGHHDEEITEVFIHQAIHTIEFVLGSVSHTASYLRLWALSLAHAQLAEVAWNMLLRKGLMSNDYQGGIFLYVVFAGWAAISVSILVLMEGLSAFLHTLRLHWVEFQSKFYGGEGYLFQPFSFEIILDSAGQAEE

Summary

Description
Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes. Required for assembly and activity of the V-ATPase.
Similarity
Belongs to the V-ATPase 116 kDa subunit family.
EMBL
AJ249390    CAB55500.1    KY921845    AVP73917.1    RSAL01000148    RVE45836.1    + More
ODYU01008280    SOQ51729.1    GDQN01002673    JAT88381.1    NEVH01014852    PNF27426.1    PNF27427.1    DS234995    EEB10093.1    ADTU01003697    ADTU01003698    ADTU01003699    ADTU01003700    KQ980882    KYN11932.1    QOIP01000007    RLU20143.1    JR036121    AEY56933.1    GDQN01005584    JAT85470.1    ATLV01025906    ATLV01025907    KE525402    KFB52672.1    GEZM01036239    JAV82869.1    KQ971311    KYB29409.1    GGFL01003956    MBW68134.1    GEZM01036241    JAV82866.1    GGFM01000911    MBW21662.1    GGFJ01001919    MBW51060.1    JXUM01092931    JXUM01092932    JXUM01092933    JXUM01092934    KQ564021    KXJ72912.1    KY921838    ART29427.1    AAAB01008888    EGK97125.1    PNF27428.1    GALX01004254    JAB64212.1    GBHO01001936    GDHC01018959    JAG41668.1    JAP99669.1    ABLF02026125    GBYB01015260    JAG85027.1    DS231912    EDS25832.1    GBRD01003998    JAG61823.1    EGK97126.1    GBHO01001931    JAG41673.1    GBYB01015261    JAG85028.1    GBRD01003999    JAG61822.1    CH933806    KRG01557.1    KRG01555.1    KB632277    ERL91208.1    KK107019    EZA62635.1    GGFK01002088    MBW35409.1    GFDF01009160    JAV04924.1    GGFM01000938    MBW21689.1    GGFJ01002002    MBW51143.1    KQ435762    KOX75459.1    APCN01003164    KRG01556.1    KRG01554.1    AXCM01000016    AXCN02001184    ADMH02001252    ETN63486.1    CH477281    EAT44941.1    GANO01000629    JAB59242.1    GAMC01017875    GAMC01017871    JAB88680.1    EAL40624.3    GBHO01001932    GDHC01015774    JAG41672.1    JAQ02855.1    GAKP01013981    GAKP01013980    JAC44971.1    JR036120    AEY56932.1    KZ288510    PBC25118.1    CH964232    KRF99395.1    GFDL01008651    JAV26394.1    GBHO01001922    GDHC01012224    JAG41682.1    JAQ06405.1    KRF99393.1    GEDC01004206    JAS33092.1    KF986377    AIY24627.1    GBGD01000470    JAC88419.1    GBRD01004000    JAG61821.1    GBXI01005967    JAD08325.1    GEBQ01031086    JAT08891.1    GFTR01008131    JAW08295.1    GAMC01017874    JAB88681.1    GDKW01001098    JAI55497.1    GEZM01036243    JAV82864.1    KRG01558.1    GECU01036404    JAS71302.1    KRG01561.1    LJIG01002646    KRT84294.1    GECZ01022307    GECZ01013541    JAS47462.1    JAS56228.1    GFXV01004708    MBW16513.1   
Pfam
PF01496   V_ATPase_I
Interpro
IPR026028   V-type_ATPase_116kDa_su_euka        + More
IPR002490   V-ATPase_116kDa_su       
PDB
6O7T     E-value=1.24199e-155,     Score=1413

Ontologies

Topology

Length:
838
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
156.16653
Exp number, first 60 AAs:
0.00088
Total prob of N-in:
0.00353
outside
1  -  401
TMhelix
402  -  424
inside
425  -  444
TMhelix
445  -  467
outside
468  -  535
TMhelix
536  -  558
inside
559  -  564
TMhelix
565  -  587
outside
588  -  649
TMhelix
650  -  672
inside
673  -  769
TMhelix
770  -  792
outside
793  -  838
 
 

Population Genetic Test Statistics

Pi
199.094363
Theta
159.245694
Tajima's D
0.75394
CLR
0.561409
CSRT
0.587770611469427
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 EMAMGVMTR 100.00 8e-05
28556443 ALLQAVLQAATGDSAAR 100.00 8e-05
28556443 DLNPDVNAFQR 100.00 2e-04
28556443 AIYHTLNLFNLDVTQK 100.00 2e-04
28556443 SLNIFGSSWR 100.00 5e-04
26822097 IEDINTVIGQTQDHR 100.00 0.012
26280517 MEQTCYNMMRK 100.00 0.012
28467696 MESTGAIIGGFAAAGDAAPGADQTMK 100.00 0.012
28556443 METIEDPPTYNR 100.00 0.012
28556443 IEDLNTVLGQTQDHR 100.00 0.012
28556443 IEDLNTVLGQTQDHR 100.00 0.012
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号