SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05355  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002381
Annotation
heat_shock_cognate_protein_[Bombyx_mori]
Full name
Heat shock 70 kDa protein cognate 4      
Location in the cell
Cytoplasmic   Reliability : 3.339
 

Sequence

CDS
ATGGCAAAAGCACCCGCAGTAGGAATCGATCTGGGTACCACGTACTCTTGCGTTGGTGTCTTCCAGCACGGGAAGGTGGAGATCATCGCCAACGACCAGGGCAACAGGACCACTCCGTCTTATGTTGCGTTCACAGACACCGAGCGTCTCATCGGAGATGCCGCCAAGAACCAGGTGGCGATGAACCCCAACAACACAATATTCGATGCCAAACGTCTCATCGGACGTAAGTTCGAAGATGCTACTGTGCAAGCCGACATGAAGCACTGGCCTTTCGAGGTTGTCAGTGATGGAGGCAAACCTAAGATCAAGGTAGCATATAAGGGTGAAGACAAAACCTTTTTCCCCGAGGAAGTCAGTTCCATGGTGCTTACGAAAATGAAGGAAACTGCCGAAGCTTATCTTGGCAAAACTGTGCAGAATGCAGTTATCACGGTTCCCGCGTACTTCAATGACTCTCAAAGACAAGCCACAAAAGATGCAGGTACCATCTCTGGCTTGAACGTTCTCCGAATCATCAATGAACCGACTGCTGCTGCGATTGCTTACGGTCTTGACAAAAAGGGTACTGGAGAACGAAATGTACTTATCTTTGACCTCGGCGGCGGTACCTTCGACGTGTCCATCCTTACCATCGAGGATGGTATCTTCGAGGTGAAATCCACCGCCGGCGACACCCACTTGGGAGGTGAGGACTTTGACAATCGCATGGTCAACCACTTTGTCCAGGAGTTCAAGAGGAAATACAAAAAGGACCTCGCTACCAACAAGAGAGCTCTTAGGCGTTTGCGTACTGCATGTGAGAGGGCAAAGAGGACCTTGTCATCGTCCACACAAGCGAGCATTGAGATAGATTCTCTCTTTGAGGGTATTGACTTCTACACGTCAATTACTCGTGCTCGCTTCGAGGAGCTGAACGCCGATCTGTTCAGGTCTACCATGGAGCCAGTGGAGAAGTCTCTCCGTGATGCCAAGATGGATAAGGCTCAAATCCACGATATTGTACTGGTGGGTGGCTCCACTCGTATCCCCAAGGTGCAGAAGCTCCTGCAAGATTTCTTTAATGGAAAGGAGCTCAACAAATCTATTAACCCTGACGAGGCCGTAGCTTATGGTGCAGCTGTCCAGGCTGCTATCTTGCACGGTGACAAGTCTGAGGAGGTGCAGGATCTGCTGTTGCTTGATGTAACACCCCTTTCCCTCGGTATTGAGACTGCTGGAGGTGTCATGACCACACTCATCAAGCGTAACACTACCATCCCCACTAAACAGACTCAGACATTCACCACCTACTCTGATAACCAACCCGGAGTACTCATCCAAGTATTTGAGGGTGAGCGTGCTATGACCAAAGATAACAACTTGCTCGGTAAATTCGAGCTGACCGGGATCCCACCGGCGCCGCGTGGCGTGCCTCAAATTGAGGTCACCTTCGACATCGATGCCAACGGTATCCTCAACGTTTCCGCTATCGAGAAGTCCACCAACAAGGAGAACAAGATCACCATTACCAACGACAAAGGTCGTCTCTCCAAGGAAGAGATCGAGCGTATGGTTAATGAGGCAGAGAAGTACAGAAACGAGGATGACAAGCAAAAGGAGACCATCCAGGCCAAGAATGCATTGGAATCTTACTGCTTCAGCATGAAGTCTACCATGGAGGATGAGAAGCTCAAGGAAAAGATCTCTGACTCTGACAAGCAGACCATCCTCGACAAGTGCAACGACACCATCAAGTGGCTGGATTCCAACCAGCTGGCCGACAAGGAGGAGTATGAGCACAAGCAGAAAGAATTGGAAGGCATTTACAATCCGATAATTACGAAGATGTACCAGGGTGCCGGAGGAGTCCCCGGAGGTATGCCGGGCTTCCCGGGCGGAGCACCCGGAGCCGGAGGTGCCGCCCCCGGGGCTGGAGGCGCTGGCCCCACCATCGAGGAGGTCGATTAA
Protein
MAKAPAVGIDLGTTYSCVGVFQHGKVEIIANDQGNRTTPSYVAFTDTERLIGDAAKNQVAMNPNNTIFDAKRLIGRKFEDATVQADMKHWPFEVVSDGGKPKIKVAYKGEDKTFFPEEVSSMVLTKMKETAEAYLGKTVQNAVITVPAYFNDSQRQATKDAGTISGLNVLRIINEPTAAAIAYGLDKKGTGERNVLIFDLGGGTFDVSILTIEDGIFEVKSTAGDTHLGGEDFDNRMVNHFVQEFKRKYKKDLATNKRALRRLRTACERAKRTLSSSTQASIEIDSLFEGIDFYTSITRARFEELNADLFRSTMEPVEKSLRDAKMDKAQIHDIVLVGGSTRIPKVQKLLQDFFNGKELNKSINPDEAVAYGAAVQAAILHGDKSEEVQDLLLLDVTPLSLGIETAGGVMTTLIKRNTTIPTKQTQTFTTYSDNQPGVLIQVFEGERAMTKDNNLLGKFELTGIPPAPRGVPQIEVTFDIDANGILNVSAIEKSTNKENKITITNDKGRLSKEEIERMVNEAEKYRNEDDKQKETIQAKNALESYCFSMKSTMEDEKLKEKISDSDKQTILDKCNDTIKWLDSNQLADKEEYEHKQKELEGIYNPIITKMYQGAGGVPGGMPGFPGGAPGAGGAAPGAGGAGPTIEEVD

Summary

Similarity
Belongs to the heat shock protein 70 family.
Keywords
ATP-binding   Nucleotide-binding   Nucleus   Stress response  
Feature
chain  Heat shock 70 kDa protein cognate 4
EMBL
BABH01011152    HQ694956    AB084922    ADW41775.1    BAB92074.1    AF194819    + More
KJ639908    AIZ00748.1    JQ340172    AFO70210.1    KJ639909    AIZ00749.1    KC844151    KF731994    AGQ50302.1    AHF81958.1    HQ223341    ADO32621.1    KX977589    ATN45248.1    JX680673    JX680674    AGR84220.1    AGR84221.1    JF809817    AEG78288.1    ODYU01008280    SOQ51731.1    DQ004584    AAY26452.2    GU433378    ADM66138.1    KC787696    AGM34286.1    AY829851    AAV91465.1    MF067297    ASM61895.1    HM046611    ADK55518.1    DQ845103    DQ845104    ABH09733.1    KX845567    ATB54998.1    EF194276    ABM90551.1    EF213550    ABN09627.1    NWSH01007300    PCG63012.1    EU306518    ABY55233.1    AB251896    BAF03556.1    GQ389712    ACV32641.1    AGBW02012297    OWR45261.1    EF190212    ABM90802.1    HQ434763    JF708083    JF708084    ADR00357.2    AEO19922.1    AEO19923.1    U23504    AAB06239.1    FJ432703    ACL31668.1    GU726137    RSAL01000148    ADE05296.1    RVE45838.1    JN676213    AFC38439.1    KQ458714    KPJ05447.1    JTDY01003535    KOB69384.1    AK404837    BAM20322.1    KQ459934    KPJ19257.1    AB214973    BAE48743.1    KJ437496    AHX58694.1    HQ698836    ADZ15147.1    AB206478    BAE44308.1    EF523379    ABP93403.1    KJ573767    AIA61347.1    GU205816    ADA61012.1    EF392678    ABN50911.1    EF190213    ABM90803.1    KF052087    AGU67952.1    KF311064    AHY95944.1    ACPB03018406    GAHY01000410    JAA77100.1    GBBI01000572    GEMB01001689    JAC18140.1    JAS01474.1    JN811146    AFG29035.1    GL440413    EFN65945.1    DS234995    EEB10106.1    KK856104    PTY24888.1    KU932322    APA33958.1    GBGD01000767    JAC88122.1    APGK01039372    APGK01039373    KB740970    ENN76652.1    KC184398    AGF33487.1    GU723301    ADE34170.1    KB632388    ERL94381.1    KQ971380    KYB25034.1    KC844150    AGQ50301.1    KQ980724    KYN14122.1    KP994340    QKKF02017343    AMD09926.1    RZF40992.1    AK416914    BAN20129.1    KR181952    ALJ76676.1    GEZM01028132    JAV86444.1    KJ909506    AIL52740.1    KX976471    AQP31361.1    KQ977199    KYN04993.1    EU340838    ACA53150.1    KK107293    QOIP01000005    EZA53152.1    RLU22879.1    KJ573768    AIA61348.1    LBMM01009632    KMQ87979.1    EF208962    ABP97091.1    JX112895    AFP54307.1    GL887707    EGI70201.1    KZ288254    PBC30723.1    JR042487    AEY59625.1    KQ435763    KOX75410.1    KQ981523    KYN40454.1    MG265904    AXU24960.1    KQ976731    KYM76299.1    ADTU01006918    GBHO01044229    JAF99374.1    GBHO01044228    GBRD01005543    JAF99375.1    JAG60278.1    GFTR01007630    JAW08796.1    KC119044    AGM20720.1    ABLF02026083    KC544268    AHA36968.1    MG265912    AXU24968.1    KY563591    ARK20000.1    KY661334    AVA17421.1   
Pfam
PF00012   HSP70        + More
PF10268   Tmemb_161AB
PF02752   Arrestin_C
PF00339   Arrestin_N
PF00069   Pkinase
Interpro
IPR029047   HSP70_peptide-bd_sf        + More
IPR013126   Hsp_70_fam       
IPR018181   Heat_shock_70_CS       
IPR029048   HSP70_C_sf       
IPR019395   Transmembrane_161A/B       
IPR014753   Arrestin_N       
IPR011021   Arrestin-like_N       
IPR014752   Arrestin_C       
IPR014756   Ig_E-set       
IPR011022   Arrestin_C-like       
IPR000719   Prot_kinase_dom       
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
SUPFAM
SSF100934   SSF100934        + More
SSF100920   SSF100920       
SSF81296   SSF81296       
SSF56112   SSF56112       
PDB
5FPN     E-value=0,     Score=2413

Ontologies

Topology

Subcellular location
Nucleus  
Length:
649
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02999
Exp number, first 60 AAs:
0.01495
Total prob of N-in:
0.00137
outside
1  -  649
 
 

Population Genetic Test Statistics

Pi
175.266163
Theta
173.958734
Tajima's D
-0.719767
CLR
0.163738
CSRT
0.1978401079946
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 APAVGIDLGTTYSCVGVFQHGK 100.00 4e-10
28556443 APAVGIDLGTTYSCVGVFQHGK 100.00 4e-10
28556443 AIAYGLDK 100.00 4e-10
28556443 YLTVAAIFR 100.00 4e-10
26822097 GEDKTFFPEEVSSMVITK 95.45 9e-10
26280517 AAIAAAVAATGVPAIVQAR 95.45 9e-10
25044914 APANTSWESGASAIEHAIK 95.45 9e-10
28467696 APAPRPQPQPQQQYR 95.45 9e-10
24093152 GVPKPEDESVANR 95.83 4e-09
26822097 SINPDEAVAYGAAVQAAIIHGDK 95.45 4e-08
26280517 SVVSGSEADAVIIR 95.45 4e-08
24402669 VAYGDANDKTSDNVGWK 95.45 4e-08
27102218 WIDSNQIADKEEYEHK 95.45 4e-08
28467696 VAYFGAPEYYIGK 95.45 4e-08
20518026 MDKGQIHDIVLVGGSTR 95.24 2e-07
20518026 TTPSYVAFTDTER 100.00 4e-07
31223520 IINEPTAAAIAYGLDKK 100.00 1e-05
26822097 IIQDFFNGK 100.00 1e-05
26280517 EIGETPSAVCK 100.00 1e-05
25044914 TVQMSEAEVR 100.00 1e-05
24093152 TVPTTPEINK 100.00 1e-05
24402669 TVPQVAIR 100.00 1e-05
27102218 ISDSDKQTIIDK 100.00 1e-05
28467696 TVQMSEAEVR 100.00 1e-05
28556443 TVQNAVITVPAYFNDSQR 100.00 1e-05
28556443 TVQNAVITVPAYFNDSQR 100.00 1e-05
28556443 TVQNAVITVPAYFNDSQR 100.00 1e-05
28556443 TTYSDNQPGVLIQVFEGER 100.00 1e-05
28556443 TTYSDNQPGVLIQVFEGER 100.00 1e-05
28556443 AVITVPAYFNDSQR 100.00 1e-05
28556443 IINEPTAAAIAYGLDKK 100.00 2e-05
28556443 IINEPTAAAIAYGLDKK 100.00 2e-05
28556443 TTPSYVAFTDTER 100.00 3e-05
28556443 TTPSYVAFTDTER 100.00 3e-05
26822097 FEITGIPPAPR 100.00 3e-05
26280517 EHEGWSVAVEK 100.00 3e-05
25044914 HWIQIIK 100.00 3e-05
24402669 HWIQIIK 100.00 3e-05
27102218 ISKEEIER 100.00 3e-05
28467696 HWIIGESIHPDSIDR 100.00 3e-05
28556443 HWPFEVVSDGGKPK 100.00 3e-05
28556443 HWPFEVVSDGGKPK 100.00 3e-05
28556443 HWPFEVVSDGGKPK 100.00 3e-05
28556443 HWPFEVVSDGGK 100.00 3e-05
28556443 HWPFEVVSDGGK 100.00 3e-05
28556443 NQVAMNPNNTIFDAK 100.00 5e-05
28556443 NQVAMNPNNTIFDAK 100.00 5e-05
31223520 TTPSYVAFTDTER 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDKK 100.00 1e-04
28556443 IINEPTAAAIAYGLDK 100.00 1e-04
28556443 IINEPTAAAIAYGLDK 100.00 1e-04
26280517 NFQEGTYIDNAHSSIISNAQYSTQAINR 100.00 1e-04
28467696 NQVAMNPNNTIFDAK 100.00 1e-04
28556443 WLDSNQLADKEEYEHK 100.00 2e-04
28556443 VEIIANDQGNR 100.00 2e-04
28556443 VEIIANDQGNR 100.00 2e-04
20518026 IINEPTAAALAYGLDK 100.00 2e-04
20518026 VINDNGKPK 100.00 2e-04
20518026 IINEPTAAALAYGLDK 100.00 2e-04
28556443 SLGIETAGGVMTTLIK 100.00 2e-04
28556443 SLGIETAGGVMTTLIK 100.00 2e-04
20518026 DAGAIAGLNVLR 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAY 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 IINEPTAAAIAYGLDK 100.00 4e-04
28556443 HWPFEVVSDGGKPK 100.00 4e-04
28556443 HWPFEVVSDGGKPK 100.00 4e-04
26822097 AAAAAAIAAADTVIR 100.00 6e-04
26280517 MQVCVIGDQQHCDEAK 100.00 6e-04
31250652 MKETAEAYLNTSVK 100.00 6e-04
28467696 NAVEVDATVSYQADER 100.00 6e-04
28556443 NAVITVPAYFNDSQR 100.00 6e-04
28556443 NAVITVPAYFNDSQR 100.00 6e-04
28556443 NALESYCFSMK 100.00 6e-04
28556443 NALESYCFSMK 100.00 6e-04
28556443 TFFPEEVSSMVLTK 100.00 7e-04
28556443 ETAEAYLGK 100.00 7e-04
20518026 TTPSYVAFTESER 100.00 9e-04
26822097 EIEGIYNPIITK 100.00 9e-04
26280517 IVPDVIPVAPTK 100.00 9e-04
25044914 NQVAINPNNTVFDAK 100.00 9e-04
24402669 NQRPVCGTDGK 100.00 9e-04
27102218 STMEDEKIKEK 100.00 9e-04
28467696 NQVAINPNNTVFDAK 100.00 9e-04
29197581 ISDSDKQTIIDK 100.00 9e-04
28556443 NQVAMNPNNTIFDAK 100.00 9e-04
28556443 NQVAMNPNNTIFDAK 100.00 9e-04
28556443 NAVITVPAYFNDSQR 100.00 9e-04
28556443 NAVITVPAYFNDSQR 100.00 9e-04
28556443 HWPFEVVSDGGK 100.00 0.002
28556443 FELTGIPPAPR 100.00 0.002
28556443 FELTGIPPAPR 100.00 0.002
28556443 ASNGDAWVQGTDGK 100.00 0.002
28556443 IINEPTAAAIAY 100.00 0.002
31223520 VEIIANDQGNR 100.00 0.004
28556443 AQIHDIVLVGGSTR 100.00 0.004
28556443 APAVGIDLGTTYSCVGVFQHGK 100.00 0.004
28556443 APAVGIDLGTTYSCVGVFQHGK 100.00 0.004
28556443 TFFPEEVSSMVLTK 100.00 0.012
28556443 TFFPEEVSSMVLTK 100.00 0.012
28556443 TFFPEEVSSMVLTK 100.00 0.012
28556443 TFFPEEVSSMVLTK 100.00 0.012
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号