SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05339  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002527
Annotation
male_reproductive_organ_angiotensin-converting_enzyme-related_protein_2_precursor_[Bombyx_mori]
Full name
Angiotensin-converting enzyme      
Location in the cell
Cytoplasmic   Reliability : 3.183
 

Sequence

CDS
ATGATAATGAAGATTATCGGGGAGCTCGCCCTTCTGGGTGCTATCGCGTCAGTCTTCCTGGTAGCAGCCCAGGGTCGGGCAGCAGAAAGAGCTGCAGAGGAATCCGCTGGGCGAGATTACGTGAGGACTTTGGACGAACAGACTTCTCGGCTCAGGAACAAGAAAACGATTGCCTCTTGGGACTATGAGACGAATTTGACAGTCCATAACGAACAGAAATTGTTACAAGTATCCTTAGAGGTGGCAAGCGAAACGAAGGAATACTGGAAGGAAACCATGAGCTACCTCTGGCACGAGTTCGAAGACCCGGACCTGAAGAGGATGTTCAAGAAATACACGGAGCTGGGCACATCAGCTCTACCCGAGGATTTGAATCAGAGATTGATCGTGGCCATCAATAGCATGCAGTCAACTTACGCTAAGGCAACGATCTGTGATTATAATAATCGGACTAAATGTGATTTGCATGTTGAACCTGAAATCACAAACATTTTTGCGACAAGCAGCGACGCTGAAGAACTCAAGTACACATGGCTTGAATGGCATAAGGCAGCGGGTGCTCCATCGAAGAGTAACTTCACCGAGTACGTTCAAATGGAGAACGAGGCTGCCAAATTAAATGGTTACGACACTGTGGCCGAATGGTGGCTTAGTGAATATGAAGCTACAGACAGCGAGGACCAGTTCGCAGCGCTCTGGGCGCAAATCAAACCGCTCTATGAACAGATTCATGCGTACGTCAGAGGGCATCTTCGTGTGAAGTATGGAGAAGAAGTCGTGCCGAAGAAAGGACCCATTCCAGCTCATTTGTTAGGTAACATTTGGGCCCAAACTTGGGGTAACGTTGAAAAATTCACAAGGCCGTATCCGGATAAGACCGATATTGATGTAACTGCCGCGCTCATTGCACAGAATTACACAGCCCTTAAGATGTTTAAGACAGCAGAGGAGTTTTTTACGTCATTGGATTTATCCCCAATGCCAGAGTTGTTCTGGGAAAGATCCATCTTAGAGAAACCAACTGATGGAAGAGAAATGGTCTGCCATGCTTCTGCTTGGGACTTTTTCGACGGTGAAGATTTCAGAATCCGTCAATGCACAACCATCACGGACGCGTTCTTCAAGACGACCCACCACGAAATGGGTCACATACAATACTACTTGCAGTACAAGGATCAGCCGGTGATCTACAGGGCTGGAGCTAATCCAGGTTTTCACGAAGCAGTTGGTGACGTCATCGCACTGTCGGTGGCAACGCCGAAACATTTACGGGTGATGGGGCTTCTCGAGGATGGACCAGAAGATTTGGAATCTAACATTAATCAGCTTTACAAAATGGGTCTGGACAAGATAGTTTTCTTACCATTCGGCTATCTCCTCGATCTCTTCCGTTATGGCGTCTTCCGAGGAACTACCACAGTTGACGACTACAATTGTCACTTCTGGCAACTAAGAGAGTCCTTGCAGGGCGTGGAACCTCCGGCGCCACGAAGCGAAGCGGACTTTGATCCTGCTGCAAAGTACCATATAGCTGCAGATGTGGAATACATGAGATACTATATCTCTTACATTATCCAGTTTCAATTCCATCGTTCGTTATGCCAGCTTGCCGGGGAGTACGCGGTTGGCGACTCCAGCAGGCTGCTCTCAAACTGCGATATTTACAACAGCACGGCGGCAGGAAACGCTCTCGGCAAAATGCTGCAATTGGGTTCTTCGAAGCCGTGGCCCGACGCGATGGAAGCGATAACTGGACAAAGGTTCATGGATGCCAGCGGCGTCCTGGAGTACTTCCAGCCTCTATACGATTGGCTCAAGGCCGAGAACGAACGAAATGGAGAATTTGTCGGTTGGGAGCCTAGTACCGTCCAATTTTGTACTCCAAACCAAAGAGCAGCGATGGAAGCGACCGGCTTTAACAAGAGATTGAAGAAATATGCAGCTCTATAG
Protein
MIMKIIGELALLGAIASVFLVAAQGRAAERAAEESAGRDYVRTLDEQTSRLRNKKTIASWDYETNLTVHNEQKLLQVSLEVASETKEYWKETMSYLWHEFEDPDLKRMFKKYTELGTSALPEDLNQRLIVAINSMQSTYAKATICDYNNRTKCDLHVEPEITNIFATSSDAEELKYTWLEWHKAAGAPSKSNFTEYVQMENEAAKLNGYDTVAEWWLSEYEATDSEDQFAALWAQIKPLYEQIHAYVRGHLRVKYGEEVVPKKGPIPAHLLGNIWAQTWGNVEKFTRPYPDKTDIDVTAALIAQNYTALKMFKTAEEFFTSLDLSPMPELFWERSILEKPTDGREMVCHASAWDFFDGEDFRIRQCTTITDAFFKTTHHEMGHIQYYLQYKDQPVIYRAGANPGFHEAVGDVIALSVATPKHLRVMGLLEDGPEDLESNINQLYKMGLDKIVFLPFGYLLDLFRYGVFRGTTTVDDYNCHFWQLRESLQGVEPPAPRSEADFDPAAKYHIAADVEYMRYYISYIIQFQFHRSLCQLAGEYAVGDSSRLLSNCDIYNSTAAGNALGKMLQLGSSKPWPDAMEAITGQRFMDASGVLEYFQPLYDWLKAENERNGEFVGWEPSTVQFCTPNQRAAMEATGFNKRLKKYAAL

Summary

Cofactor
Zn(2+)
Similarity
Belongs to the peptidase M2 family.
Feature
chain  Angiotensin-converting enzyme
EC Number
3.4.-.-
EMBL
BABH01011115    BABH01011116    AB485781    BAH23569.1    EU170161    ABW34729.1    + More
ODYU01003823    SOQ43060.1    AGBW02010565    OWR48272.1    RSAL01000066    RVE49365.1    GDQN01008554    JAT82500.1    KQ459934    KPJ19243.1    NWSH01006011    PCG63754.1    JTDY01000210    KOB78277.1    AB026110    AB485780    BAA97657.1    BAH23568.1    OWR48273.1    KQ458714    KPJ05462.1    RVE49366.1    KQ461002    KPJ10041.1    ODYU01000895    SOQ36342.1    AK401523    BAM18145.1    DS235848    EEB18604.1    KU218691    ALX00071.1    GFDL01004760    JAV30285.1    NEVH01011186    PNF32210.1    PNF32208.1    CH477248    EJY57431.1    GEZM01002421    JAV97269.1    GFDL01004795    JAV30250.1    AY487174    AAR85358.1    KQ435827    KOX71968.1    KU932237    APA33873.1    GAPW01000528    JAC13070.1    GAPW01000531    JAC13067.1    GAPW01000530    JAC13068.1    GAPW01000529    JAC13069.1    KQ762196    OAD56126.1    KC437298    AGC79111.1    DS232053    EDS33274.1    ADMH02001324    ETN63008.1    JR048421    AEY60659.1    KZ288322    PBC28134.1    KK107013    QOIP01000003    EZA62925.1    RLU25153.1    KQ971380    EEZ97252.2    JXUM01065208    JXUM01065209    KQ562335    KXJ76120.1    KU764440    AQS60686.1    GGFK01007818    MBW41139.1    GGFK01007715    MBW41036.1    GGFK01007707    MBW41028.1    GGFK01007699    MBW41020.1    GGFL01015113    MBW79291.1    GAMD01000546    JAB01045.1    KQ414954    KOC59071.1    PNF32211.1    AAAB01008980    EAU76040.2    APCN01001774    GGFJ01003206    MBW52347.1    GGFJ01003160    MBW52301.1    GGFJ01003208    MBW52349.1    GGFJ01003159    MBW52300.1    GGFJ01003207    MBW52348.1    AXCM01007217    AXCN02000684    KQ434943    KZC12209.1    ATLV01015459    KE525014    KFB40454.1    JXUM01016020    JXUM01016021    KQ560447    KXJ82379.1    KFB40455.1    EAA14501.5    GFDL01008681    JAV26364.1    GFDL01008678    JAV26367.1    GEDC01000545    JAS36753.1    EAU76041.1    GFDL01008546    JAV26499.1    GEDC01028238    JAS09060.1    GEDC01024908    GEDC01014015    JAS12390.1    JAS23283.1    GFDL01008526    JAV26519.1    AY455911    AAS16911.1    GFDF01005267    JAV08817.1    GGMS01007793    MBY76996.1    GAMD01000383    JAB01208.1    UFQS01000326    UFQT01000326    SSX02915.1    SSX23282.1    ABLF02025366   
Pfam
PF01401   Peptidase_M2        + More
PF05160   DSS1_SEM1
Interpro
IPR001548   Peptidase_M2        + More
IPR011989   ARM-like       
IPR007834   DSS1_SEM1       
Gene 3D
PDB
5A2R     E-value=0,     Score=1632

Ontologies

Topology

SignalP
Position:   1 - 27,         Likelihood:  0.602732
 
 
Length:
649
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.55305
Exp number, first 60 AAs:
12.10793
Total prob of N-in:
0.60419
POSSIBLE N-term signal
sequence
outside
1  -  649
 
 

Population Genetic Test Statistics

Pi
269.074152
Theta
137.055457
Tajima's D
2.988655
CLR
0.313824
CSRT
0.980800959952002
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 FTRPYPDK 100.00 6e-10
28556443 YFQELDYGHDFYATQTIQGDGK 100.00 6e-10
28556443 SILEKPTDGR 100.00 1e-09
28556443 MLQLGSSKPWPDAMEAITGQR 100.00 1e-08
28556443 ETMSYLWHEFEDPDLKR 100.00 1e-08
28556443 IKPLYEQIHAYVR 100.00 1e-08
28556443 CDLHVEPEITNIFATSSDAEELK 100.00 2e-08
28556443 SEADFDPAAK 100.00 2e-06
28556443 ESLQGVEPPAPR 100.00 6e-06
28556443 ESLQGVEPPAPR 100.00 6e-06
28556443 NIWAQTWGNVEK 100.00 3e-05
28556443 YTELGTSALPEDLNQR 100.00 2e-04
28556443 SILEKPTDGR 100.00 2e-04
28556443 MLQLGSSKPWPDAMEAITGQR 100.00 2e-04
26822097 ADGIIEYFRPIHDWIR 100.00 0.004
28556443 AGANPGFHEAVGDVIALSVATPK 100.00 0.005
28556443 LIVAINSMQSTYAK 100.00 0.005
28556443 ETMSYLWHEFEDPDLKR 100.00 0.011
28556443 VMGLLEDGPEDLESNINQLYK 100.00 0.028
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号