SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05338  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002526
Annotation
PREDICTED:_ecdysteroid-inducible_angiotensin-converting_enzyme-related_gene_product_isoform_X4_[Bombyx_mori]
Full name
Angiotensin-converting enzyme      
Location in the cell
Cytoplasmic   Reliability : 2.886
 

Sequence

CDS
ATGCTGAAAGTGGGGGGCGGTGCGGTATTGATCGCGGCGATCGTTGCCGTGTTCATCGTGGCCACTCAGGGACGGGACCCGGACCTCGAGGCGCGGGAGCACGAGGCGCGGGAGTACATGCTGCATCTGGATAAAGCGACCGGCCTGAGGAAGAACAGGGCCAGCTTAGCCGAATGGGAGTACACCTCGAATATCACGAAGGAGAACGAAGAGAAATCGATACAAACTCACCTGGAGCTCTCGCGTCAAGAGAAAGCAGCCTGGGAGGAGACCAAGATGTACGGGTGGCAGGACTTCCAGGATTTCACGTTGCGTAGAATGTTCAAGAAATACAGTCAGCTGGGCGTTGCGGCTCTGCCTGACGACAAATTCCAAGCTTTGATGAGAACTGTGTCTGGAATGGAATCGAACTATGCCACTGCGAAGATCTGCTCGTACAAGAATGAAAGTAAATGCGATCTATCTTTGGAGCCTGAGATAACTGAAATATTCTCCACGAGCCAAGACCCTGAGGAGTTGAAGCATGCCTGGGTGGAGTGGCACAACGCGGCCGGCGCGACAGCGAAGAAGAACTTCACCGACTACGTGAACCTTTACAACGAGGCCGCCAAGCTTAATGGTTTCGATAACGTAGCCGAATGGTGGCAATCAGAATACGAGGTACCGGACTTCGAGGAGCAGCTGGCGAAGCTGTGGGAGGACGTGAAGCCTCTGTACCAGCAGCTGCACGCCTACGTCAGGAAGAGGCTGCGGGACAAGTACGGAGACAAGGTCGTGTCCGCCAGAGGACCGATACCGGCGCATTTACTGGGCAACATGTGGGCCCAGACGTGGAACAACATCGAATCCTTCACTCGTCCTTATCCGGACAAGAAGGAGATCGACGTCACACAAGCGATGAGAGACCAGAACTACACTCCGATGAAGATGTTTCAAATGTCAGACGAATTCTTTAGGTCGTTGAACTTGACCGCTATGCCCGAGAAGTTCTGGAAGAACTCTATAATAGAGAAGCCGACGGATAGAGAAATCGTTTGTCACGCCTCCGCCTGGGACTTCTTTGATGGTGAAGATTTTAGGATCAAAATGTGCACGACGGTGAACGTGGAACACCTGAGGACGGTGCACCACGAGATGGGACACATTCAGTATTTCTTGCAGTACAGACATCAGCCTTCGGTCTTCCGCGAGGGAGCGAATTCAGGTTTCCACGAAGCGGTCGGGGACACGATAGCTCTCTCGGTGTCGTCACCGAAACATCTGCGTCGGGTCGGTCTGGCCACGGGCGATGCCGAGGACGAACAGACAGAGATCAATCAGCTTTATAAGATGGGAATAGACAAGATCGCATTCCTACCGTTCGCATACACCCTGGACCTGTTCCGATACGGTGTGTTCAGAAGGAAGACGCTGCCGGAAGACTACAACTGCCACTACTGGAAGCTAAGGGAGCAGCTACAAGGCGTGGAGCCGCCCGTCAATAGAACTGAGGACGACTTCGACGCCGCAGCCAAGTACCATGTGTCTGCCAACGTCGAATACGCCAGATATTACGTGTCGTTCATAATCCAGTTCCAGTTCCACCGTGCGCTGTGCCAGCTGGCGGGCGAGCACGCGGCCGGGGACCCCAACAAGAAGCTGGTCGACTGCGACATCTACCAGAGCGTCGCCGCCGGGAACGCGCTCGCAAACATGCTGAAGATGGGTTCGTCTAAGCCCTGGCCGGACGCGATGGAGGCGCTGACCGGACAGCGGGAGATGAAGGCAGACGGCCTCCTGGAGTACTTCCGGCCGCTCCACGACTGGCTGCGGGCGGAGAACCAGCGGACCGGCGAGCACATCGGCTGGGAACCGACCAACATGGAGTACTGCACGCCGAGCCAATTGTCGGAGCTAAACGTGAAGGAGCCGGCGTCGAGTCCAGCGACGCAACAATCTGACTCTTGA
Protein
MLKVGGGAVLIAAIVAVFIVATQGRDPDLEAREHEAREYMLHLDKATGLRKNRASLAEWEYTSNITKENEEKSIQTHLELSRQEKAAWEETKMYGWQDFQDFTLRRMFKKYSQLGVAALPDDKFQALMRTVSGMESNYATAKICSYKNESKCDLSLEPEITEIFSTSQDPEELKHAWVEWHNAAGATAKKNFTDYVNLYNEAAKLNGFDNVAEWWQSEYEVPDFEEQLAKLWEDVKPLYQQLHAYVRKRLRDKYGDKVVSARGPIPAHLLGNMWAQTWNNIESFTRPYPDKKEIDVTQAMRDQNYTPMKMFQMSDEFFRSLNLTAMPEKFWKNSIIEKPTDREIVCHASAWDFFDGEDFRIKMCTTVNVEHLRTVHHEMGHIQYFLQYRHQPSVFREGANSGFHEAVGDTIALSVSSPKHLRRVGLATGDAEDEQTEINQLYKMGIDKIAFLPFAYTLDLFRYGVFRRKTLPEDYNCHYWKLREQLQGVEPPVNRTEDDFDAAAKYHVSANVEYARYYVSFIIQFQFHRALCQLAGEHAAGDPNKKLVDCDIYQSVAAGNALANMLKMGSSKPWPDAMEALTGQREMKADGLLEYFRPLHDWLRAENQRTGEHIGWEPTNMEYCTPSQLSELNVKEPASSPATQQSDS

Summary

Cofactor
Zn(2+)
Similarity
Belongs to the peptidase M2 family.
Feature
chain  Angiotensin-converting enzyme
EC Number
3.4.-.-
EMBL
BABH01011115    AB026110    AB485780    BAA97657.1    BAH23568.1    KQ458714    + More
KPJ05462.1    KQ461002    KPJ10041.1    ODYU01000895    SOQ36342.1    AGBW02010565    OWR48273.1    RSAL01000066    RVE49366.1    JTDY01000210    KOB78277.1    AK401523    BAM18145.1    OWR48272.1    ODYU01003823    SOQ43060.1    EU170161    ABW34729.1    BABH01011116    GDQN01008554    JAT82500.1    RVE49365.1    AB485781    BAH23569.1    KQ459934    KPJ19243.1    NWSH01006011    PCG63754.1    KU218691    ALX00071.1    NEVH01011186    PNF32210.1    PNF32208.1    AY487174    AAR85358.1    KU932237    APA33873.1    KU764440    AQS60686.1    KC437298    AGC79111.1    CH477248    EJY57431.1    GAPW01000531    JAC13067.1    GAPW01000529    JAC13069.1    PNF32211.1    GAPW01000530    JAC13068.1    GAPW01000528    JAC13070.1    ADMH02001324    ETN63008.1    GFDL01004760    JAV30285.1    GFDL01004795    JAV30250.1    GGFL01015113    MBW79291.1    GEZM01002421    JAV97269.1    JXUM01065208    JXUM01065209    KQ562335    KXJ76120.1    EJY57432.1    KQ435827    KOX71968.1    APCN01001774    ATLV01015459    KE525014    KFB40455.1    DS232053    EDS33274.1    KQ762196    OAD56126.1    KB632277    ERL91207.1    GGFK01007715    MBW41036.1    GGFJ01003160    MBW52301.1    GGFK01007707    MBW41028.1    GGFJ01003208    MBW52349.1    JXUM01016020    JXUM01016021    KQ560447    KXJ82379.1    GGFJ01003206    MBW52347.1    GFDL01008681    JAV26364.1    GGFK01007818    MBW41139.1    GGFK01007699    MBW41020.1    GFDL01008678    JAV26367.1    GGFJ01003159    MBW52300.1    GGFJ01003207    MBW52348.1    GFDL01008546    JAV26499.1    GFDL01008526    JAV26519.1    EDS33273.1    AAAB01008980    EAU76037.2    GAMD01000546    JAB01045.1    AXCM01007217    GFTR01007468    JAW08958.1    GEDC01000545    JAS36753.1    DS235848    EEB18604.1    ETN63011.1    GEDC01028238    JAS09060.1    GEDC01024908    GEDC01014015    JAS12390.1    JAS23283.1    KQ971380    EEZ97252.2    KQ434943    KZC12209.1    KY031095    ATU82846.1    ACPB03016228    KQ414954    KOC59071.1    EAU76040.2    AXCN02000684   
Pfam
PF01401   Peptidase_M2        + More
PF05160   DSS1_SEM1
Interpro
IPR001548   Peptidase_M2        + More
IPR011989   ARM-like       
IPR007834   DSS1_SEM1       
Gene 3D
PDB
5A2R     E-value=0,     Score=1675

Ontologies

Topology

SignalP
Position:   1 - 24,         Likelihood:  0.796706
 
 
Length:
648
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
17.7533099999999
Exp number, first 60 AAs:
17.56389
Total prob of N-in:
0.91066
POSSIBLE N-term signal
sequence
inside
1  -  4
TMhelix
5  -  22
outside
23  -  648
 
 

Population Genetic Test Statistics

Pi
229.072229
Theta
161.621061
Tajima's D
2.316762
CLR
0.369099
CSRT
0.926253687315634
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
24402669 YHVSANVEYAR 100.00 9e-11
26822097 KTIPEDYNCHYWK 100.00 2e-07
24402669 EITPHYIK 100.00 2e-07
29197581 EIDVTQAMR 100.00 2e-07
26822097 MGSSKPWPDAMEAITGQR 100.00 6e-04
29197581 EYMIHIDK 100.00 6e-04
28556443 AGANPGFHEAVGDVIALSVATPK 100.00 0.008
28556443 LIVAINSMQSTYAK 100.00 0.008
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号