SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05336
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.284 Nuclear   Reliability : 2.107
 

Sequence

CDS
ATGGAGTGGACGCTTAAAGAAGACCGTGTTGCAGTTATTGCGTTGCATAGTTGCGTTTACGCGCCAATTAAAATTTTTAACATACTGAAAAATTTGAATATAACCAAAAGATTCGTTTATCGTACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAGGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCAAATTCAAAGTAATCCCAAACGTAAGCAGAAACTGTGGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGTACGCGGGAAAAAAATATCGGATAATTCTTTTTTCGGATGAAACATTTTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTATGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGAATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGAAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MEWTLKEDRVAVIALHSCVYAPIKIFNILKNLNITKRFVYRTIKRYNEDSSVDDRSRSGRPRSVRTPAVIKAVKAQIQSNPKRKQKLWALQMGLSRTTVKRVLNEDLGLRAYRRKTGHRLNARLMDLRLKRCRALLKRYAGKKYRIILFSDETFFTVEESYNKQNDKVYAHSSEEASNRIPRVQRGHFPSSLMVWLGVSYWGLTEVHFCEKGVKTNAVVNQNTVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEKKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB363006    AB363010    + More
AB363014    BAG15923.1    BAG15924.1    AB363018    BAG15926.1    AB473770    BAH20555.1    RSAL01000063    RVE49524.1    RSAL01000012    RVE53510.1    RSAL01000022    RVE52367.1    RSAL01000021    RVE52408.1    U47917    AAB47739.1    RSAL01000140    RVE46091.1    RSAL01000133    RVE46339.1    JF779677    AEO90418.1    RSAL01000470    RVE41612.1    LNIX01000030    OXA41211.1    JARK01000176    EYC41234.1    PDUG01000006    PIC20538.1    JARK01001345    EYC27589.1    JARK01000255    EYC39473.1    CAVP010059404    CDL95787.1    UYSL01019905    VDL71189.1    JARK01001411    EYC06502.1    DS268747    EFP00909.1    JARK01000059    EYC44525.1    DS268612    EFO94085.1    PDUG01000005    PIC28734.1    PIC23776.1    DS268492    EFP11689.1    JOJR01000583    RCN36166.1    DS268508    EFO83264.1    DS268421    EFO88618.1    JOJR01000015    RCN51257.1    DS268673    EFO98001.1    DS268466    EFP06959.1    DS268525    EFO85497.1    JARK01001601    EYB87313.1    PDUG01000012    PIC13506.1    DS268679    EFO98285.1    DS268428    EFO94379.1    PDUG01000001    PIC51673.1    JARK01001337    EYC34439.1    JARK01001658    EYB84158.1    PIC29926.1    DS268545    EFO88382.1    UYSL01019770    VDL69590.1    KX931010    APL98300.1    DS268565    EFO90304.1    PDUG01000004    PIC32571.1    DS268539    EFO88027.1    UZAH01029309    VDP05368.1    UYSL01020440    VDL74616.1    LFYR01002220    KMZ56176.1    UZAH01027257    VDO90094.1    DS268606    EFO93488.1    KN728607    KIH63514.1    PIC32570.1   
Pfam
PF00019   TGF_beta        + More
PF16095   COR
PF00069   Pkinase
PF13358   DDE_3
PF00292   PAX
PF10320   7TM_GPCR_Srsx
PF00250   Forkhead
Interpro
IPR009057   Homeobox-like_sf        + More
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR032171   COR       
IPR020859   ROC_dom       
IPR000719   Prot_kinase_dom       
IPR011047   Quinoprotein_ADH-like_supfam       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR027417   P-loop_NTPase       
IPR036388   WH-like_DNA-bd_sf       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036906   ATPase_V1_fsu_sf       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR019424   7TM_GPCR_Srsx       
IPR036390   WH_DNA-bd_sf       
IPR001766   Fork_head_dom       
IPR030456   TF_fork_head_CS_2       
SUPFAM
SSF46689   SSF46689        + More
SSF57501   SSF57501       
SSF56112   SSF56112       
SSF52540   SSF52540       
SSF50998   SSF50998       
SSF46785   SSF46785       
Gene 3D
PDB
5CR4     E-value=1.40411e-08,     Score=141

Ontologies

Topology

Subcellular location
Secreted  
Nucleus  
Length:
346
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.96539999999999
Exp number, first 60 AAs:
6.38607
Total prob of N-in:
0.11325
outside
1  -  346
 
 

Population Genetic Test Statistics

Pi
77.586836
Theta
43.787278
Tajima's D
1.730096
CLR
0.541554
CSRT
0.836458177091145
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号