SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO05335
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.081 Nuclear   Reliability : 1.411
 

Sequence

CDS
ATGATGGCACACTTTAAAACAAAATTACCCCAGGAGGGTACCACCCTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGAAGCATGCTGCCCCGCGTATTCTGGGGGGGGCAAAGCATGCCACGGTGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGACAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGAAGGCGAGGCGGCAGGTCCGAAAGGGACAACCGCCAAGAAGATGAGGCGGAAGAGGAAGTCTTGGCGAGCTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCATCCTCTGGCGCAGATGCCCCGCCGGAAAAGGTGTTGGTAATCTCCGATGCAGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAGAGGGAGACCCGCCCGGAAAAGGGGCGCGCCGTCACCGGCGCCATCATCAGTCTCAATGTCTGTCGCCTCGTTGGATGGGCAGACGACAGAGGAGGAAGAGAGCGGCCTTCAGGATCCTGCCATGGTCATAGACAGGGCCATGAAGACCGTGAAATCATACGCGGCCAATGGCACCAAGACCAAAGTCGCTGGCCGTAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAAGTTCTGCCATCAGTTGCTTCTGCCAATGACCGGGTGGTACAGCTGATGGCGGAGAATTCGAGACTTCGAGCACAGCTCCAAGCTCGGCAACGGCCCGATGATGGAGCAGCGACGTCCTGGGTCGCTGGAGCCCCTCGGAGCTCCCGTCTCCCGGCGCTGACTGGTGATCAGTGGCCTGTGCTGCCACCACCGCGTGCGGCACAGGAGCGTCCGCGTCTCCCGTCGCCGCGCTCTAGAGAGACGACCGCCGCCGAGCGGCAGCAAGCACTCGCGGGGCCACGGATGCTGGCTCCGCCAGAACCGAAGGCCTTCAGCCTGGACGAGGTCATCAACCGCACCGTCCAGGCTGTAGTAGAAAAGCTGGGCGGCAGGCTAGCGGCTCTCGAGGCGAGAGTGACTGCTTCGGCCGACGTTAGACAACCGGCGGTGTCGGGTGCTTTGGCCACCCGTTCCGCTCCCGTACGGGCTCCGGCCACCAGGTCGGGCCCGGGACGAGATCGAACCAAACAAGGGGGTGGCGCTAACGCGAAGCCTCCATCACAAGCACCCCAGTCCCGTCCGCTGCCTCCGCCCCCGTCAAACATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGTGCCAAAAAGGCTTCACTGGGAGCTCCCCAAATGGGTAGAGCGTTAGTGGCCATGGCGGCTCAGGCTGCACCCCAACAGGGTCGAGCACCTGTAGCCGCCAAGGGCATGACATATAATAATGTGATGGCCCGGGCGCGTGAAGCAATCAACCTGGACGAGATTGGGGCGGAGGAAGGCCTCCGCAGCAGGCAGACGGCCAATGGGGCCAAGCTGTTAGAATGTCCCGGTGCCGATAGTCCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTATGGTCTTGCCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTAAAAATGGCGGAATTAAGAGTGACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGAGAGCAGCCGTCGCTACCCAGGGCAACTGTGCACCGGAGAATGTGACCGTGGGTGAGCTGCGCCGTGGTTATACCGGGGCCAGCTCAGTGTGGGTGCGTTGCCCGTTGGAGACGGCTGCCTCCCTGGCTGCTCCTCCGCCCGGGGGACCGTCGGGGAATCCAGGCAGGCTGCGCGTGGGCTGGATGGCGGCCCATGTGCGCCTGCTTGAACCACGCGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGACACGGTCTCGCCAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCGCGGCCGCCCCGCACTGCGCTTTGTGCGCTGCGGCCGGGCGCGGGGCTAACCACCGAGCGGGAGGAAAGGCGTGCCTCCCGTCCGGTGATAACACCGAACGCAACCGGCACCGGAAGTCAAAGCGCCGGCAGAAGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGTATGGCGGAGTGGTCTATAGATGTGGCTGTGGTCGCCGAGCCATATTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGCCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGATCTCAACGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGTCCAGCCATCGCGCGCCGTATCTGCGACTGGAAGGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCACAGTCGCAGACGTCCACGGGGACCACCCCCGTAGTGCGTCTCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTATAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGAGCGAGGCGGGGTGGTTCCGGGACACGATGCGTCGCATTTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGACATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCAGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGCCCCTGCTGAGGTGCCCCGTATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGTGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTAGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTTATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCATATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGTCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGGCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMAHFKTKLPQEGTTLGGESLRASTSVEACCPAYSGGGKACHGEGGCATGSGKPVEPRCDSAGSTRSALVSEGEAAGPKGTTAKKMRRKRKSWRASSREGVGEPASSSGADAPPEKVLVISDAASAAEEMPPPRGRPARKRGAPSPAPSSVSMSVASLDGQTTEEEESGLQDPAMVIDRAMKTVKSYAANGTKTKVAGRKLREVVSQVSKVLPSVASANDRVVQLMAENSRLRAQLQARQRPDDGAATSWVAGAPRSSRLPALTGDQWPVLPPPRAAQERPRLPSPRSRETTAAERQQALAGPRMLAPPEPKAFSLDEVINRTVQAVVEKLGGRLAALEARVTASADVRQPAVSGALATRSAPVRAPATRSGPGRDRTKQGGGANAKPPSQAPQSRPLPPPPSNMDEGWNVVARRGAKKASLGAPQMGRALVAMAAQAAPQQGRAPVAAKGMTYNNVMARAREAINLDEIGAEEGLRSRQTANGAKLLECPGADSPGIAERLAAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVRAAVATQGNCAPENVTVGELRRGYTGASSVWVRCPLETAASLAAPPPGGPSGNPGRLRVGWMAAHVRLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCAAAPHCALCAAAGRGANHRAGGKACLPSGDNTERNRHRKSKRRQKRKLARGALANAVIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIAIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRICDWKVLEGAETLSDHRYIRFDLSARSTVADVHGDHPRSASRSFPKWALKRLNKELLMEASIVAAWAPMRPHPVEVESEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMPQQLRDIVSALFPQEREGFVAPAMDAPPDYDGEAPAEVPRITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLRLGPRRVPPVDAHIVVGGVHIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYKWRADLRARGVARPSPSVVRARRGQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=2.77949e-10,     Score=163

Ontologies

Topology

Length:
1729
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.623009999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1729
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
230.015996
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号